Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633259_a_at:

>probe:Drosophila_2:1633259_a_at:191:65; Interrogation_Position=101; Antisense; ATGGTGGTTACTCGCAGTGCAGCTA
>probe:Drosophila_2:1633259_a_at:536:219; Interrogation_Position=141; Antisense; AAGTGCTGACCTTATCTGACCAGAA
>probe:Drosophila_2:1633259_a_at:559:107; Interrogation_Position=162; Antisense; AGAACATCCTAGCAGAATCTTCGAG
>probe:Drosophila_2:1633259_a_at:510:271; Interrogation_Position=17; Antisense; CATCTTATTGCACTTCGCTTGAATC
>probe:Drosophila_2:1633259_a_at:84:715; Interrogation_Position=181; Antisense; TTCGAGGACCAAAGGACCTCCTGTG
>probe:Drosophila_2:1633259_a_at:355:131; Interrogation_Position=196; Antisense; ACCTCCTGTGCCCAAGAAGAATGTT
>probe:Drosophila_2:1633259_a_at:262:211; Interrogation_Position=221; Antisense; AAGAAATTGCCGACTGCACGTCAGT
>probe:Drosophila_2:1633259_a_at:508:81; Interrogation_Position=252; Antisense; AGGTGGCTGCAAATCTTCTAGACGC
>probe:Drosophila_2:1633259_a_at:121:343; Interrogation_Position=33; Antisense; GCTTGAATCTACACCAAATTTCCAT
>probe:Drosophila_2:1633259_a_at:706:175; Interrogation_Position=389; Antisense; AAACTACTGGCTTCCAAAACTCCAG
>probe:Drosophila_2:1633259_a_at:399:193; Interrogation_Position=406; Antisense; AACTCCAGAAGCAGCGACAAACGAT
>probe:Drosophila_2:1633259_a_at:266:455; Interrogation_Position=521; Antisense; GATCACATCGAACATCAAGCCGAAT
>probe:Drosophila_2:1633259_a_at:310:365; Interrogation_Position=542; Antisense; GAATAATTTGTATCACGTTGCGTTA
>probe:Drosophila_2:1633259_a_at:132:641; Interrogation_Position=78; Antisense; TCTACGTTAGCTTTGAACCGAAAAT

Paste this into a BLAST search page for me
ATGGTGGTTACTCGCAGTGCAGCTAAAGTGCTGACCTTATCTGACCAGAAAGAACATCCTAGCAGAATCTTCGAGCATCTTATTGCACTTCGCTTGAATCTTCGAGGACCAAAGGACCTCCTGTGACCTCCTGTGCCCAAGAAGAATGTTAAGAAATTGCCGACTGCACGTCAGTAGGTGGCTGCAAATCTTCTAGACGCGCTTGAATCTACACCAAATTTCCATAAACTACTGGCTTCCAAAACTCCAGAACTCCAGAAGCAGCGACAAACGATGATCACATCGAACATCAAGCCGAATGAATAATTTGTATCACGTTGCGTTATCTACGTTAGCTTTGAACCGAAAAT

Full Affymetrix probeset data:

Annotations for 1633259_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime