FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633260_at:

>probe:Drosophila_2:1633260_at:455:197; Interrogation_Position=116; Antisense; AACGGAGAGTTCGATGCTGTGCAAG
>probe:Drosophila_2:1633260_at:669:445; Interrogation_Position=128; Antisense; GATGCTGTGCAAGACGCTTTTCAGA
>probe:Drosophila_2:1633260_at:350:411; Interrogation_Position=140; Antisense; GACGCTTTTCAGAATGATGCACAAA
>probe:Drosophila_2:1633260_at:162:209; Interrogation_Position=182; Antisense; AAGGGCCGTTTTCCAGTACACTATG
>probe:Drosophila_2:1633260_at:577:257; Interrogation_Position=200; Antisense; CACTATGCAGCAGATTTTGGACAAC
>probe:Drosophila_2:1633260_at:698:169; Interrogation_Position=22; Antisense; AAAGTTCCATCCCTAGCAGTATTTG
>probe:Drosophila_2:1633260_at:563:229; Interrogation_Position=227; Antisense; AATGTCCTGGAGTTTCTTATAAGCT
>probe:Drosophila_2:1633260_at:603:9; Interrogation_Position=296; Antisense; ATTCTGGCTGCCATTTGGGAAGGAC
>probe:Drosophila_2:1633260_at:720:21; Interrogation_Position=321; Antisense; ATACGAGCTGTGTGGAATTACTTCT
>probe:Drosophila_2:1633260_at:90:169; Interrogation_Position=364; Antisense; AAATGGTTCTACTCCAGATGGCCAA
>probe:Drosophila_2:1633260_at:538:349; Interrogation_Position=37; Antisense; GCAGTATTTGACAAGTCGGCCCAAA
>probe:Drosophila_2:1633260_at:451:93; Interrogation_Position=379; Antisense; AGATGGCCAAAGCTACCTCGAGGCG
>probe:Drosophila_2:1633260_at:236:211; Interrogation_Position=422; Antisense; AAGAAACTCCTTGCATAATATGTAC
>probe:Drosophila_2:1633260_at:711:59; Interrogation_Position=523; Antisense; ATGTCAACTATTTATTTCGATGCTT

Paste this into a BLAST search page for me
AACGGAGAGTTCGATGCTGTGCAAGGATGCTGTGCAAGACGCTTTTCAGAGACGCTTTTCAGAATGATGCACAAAAAGGGCCGTTTTCCAGTACACTATGCACTATGCAGCAGATTTTGGACAACAAAGTTCCATCCCTAGCAGTATTTGAATGTCCTGGAGTTTCTTATAAGCTATTCTGGCTGCCATTTGGGAAGGACATACGAGCTGTGTGGAATTACTTCTAAATGGTTCTACTCCAGATGGCCAAGCAGTATTTGACAAGTCGGCCCAAAAGATGGCCAAAGCTACCTCGAGGCGAAGAAACTCCTTGCATAATATGTACATGTCAACTATTTATTTCGATGCTT

Full Affymetrix probeset data:

Annotations for 1633260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720