Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633261_a_at:

>probe:Drosophila_2:1633261_a_at:514:521; Interrogation_Position=393; Antisense; GTGGCCTACATAGTGTTCGAGAAGA
>probe:Drosophila_2:1633261_a_at:624:39; Interrogation_Position=426; Antisense; ATCGGCAAGGCGCTGGCACTAAAGA
>probe:Drosophila_2:1633261_a_at:709:211; Interrogation_Position=447; Antisense; AAGAGCATTGACCTGTTCAACAGCA
>probe:Drosophila_2:1633261_a_at:528:113; Interrogation_Position=468; Antisense; AGCAGCGGCGAGTGCATCGTCAAGA
>probe:Drosophila_2:1633261_a_at:159:253; Interrogation_Position=488; Antisense; CAAGACCGGCATGGAGCTGTGGCAC
>probe:Drosophila_2:1633261_a_at:643:487; Interrogation_Position=518; Antisense; GTACGACTGCAATTACCTGCTGGAT
>probe:Drosophila_2:1633261_a_at:10:455; Interrogation_Position=563; Antisense; GATCAGCAAGTACATGGCCGGCTAC
>probe:Drosophila_2:1633261_a_at:239:647; Interrogation_Position=652; Antisense; TCACCGTCGGCAAGGAGGGTCGCAA
>probe:Drosophila_2:1633261_a_at:187:537; Interrogation_Position=669; Antisense; GGTCGCAATGCTGGCTTCGAGCAGA
>probe:Drosophila_2:1633261_a_at:248:275; Interrogation_Position=683; Antisense; CTTCGAGCAGAAGGCGTCCGTAATT
>probe:Drosophila_2:1633261_a_at:402:711; Interrogation_Position=762; Antisense; TTCTACACCTTCCAAATACGCGAGA
>probe:Drosophila_2:1633261_a_at:298:393; Interrogation_Position=838; Antisense; GAAAGATCGGGCTGCTCAAGCAGTC
>probe:Drosophila_2:1633261_a_at:13:313; Interrogation_Position=865; Antisense; GCCGCTTCAAACCATTTTAGTCCGT
>probe:Drosophila_2:1633261_a_at:290:693; Interrogation_Position=881; Antisense; TTAGTCCGTACGCATAGGTTAAGCA

Paste this into a BLAST search page for me
GTGGCCTACATAGTGTTCGAGAAGAATCGGCAAGGCGCTGGCACTAAAGAAAGAGCATTGACCTGTTCAACAGCAAGCAGCGGCGAGTGCATCGTCAAGACAAGACCGGCATGGAGCTGTGGCACGTACGACTGCAATTACCTGCTGGATGATCAGCAAGTACATGGCCGGCTACTCACCGTCGGCAAGGAGGGTCGCAAGGTCGCAATGCTGGCTTCGAGCAGACTTCGAGCAGAAGGCGTCCGTAATTTTCTACACCTTCCAAATACGCGAGAGAAAGATCGGGCTGCTCAAGCAGTCGCCGCTTCAAACCATTTTAGTCCGTTTAGTCCGTACGCATAGGTTAAGCA

Full Affymetrix probeset data:

Annotations for 1633261_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime