Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633262_s_at:

>probe:Drosophila_2:1633262_s_at:338:205; Interrogation_Position=202; Antisense; AAGCGCACGAGGCAACGCTCGAAAA
>probe:Drosophila_2:1633262_s_at:233:389; Interrogation_Position=222; Antisense; GAAAAAGGAGCCAACGCAGCCGTTT
>probe:Drosophila_2:1633262_s_at:151:199; Interrogation_Position=234; Antisense; AACGCAGCCGTTTACCGTTAGTCAG
>probe:Drosophila_2:1633262_s_at:543:473; Interrogation_Position=250; Antisense; GTTAGTCAGCTGTTTACCGTTCCGC
>probe:Drosophila_2:1633262_s_at:493:469; Interrogation_Position=268; Antisense; GTTCCGCCGCGAGATCGAAAACCGA
>probe:Drosophila_2:1633262_s_at:711:443; Interrogation_Position=280; Antisense; GATCGAAAACCGAGAATTTTTGCCG
>probe:Drosophila_2:1633262_s_at:447:233; Interrogation_Position=382; Antisense; AATCGCCGAAAAGCCGATAGTGCAA
>probe:Drosophila_2:1633262_s_at:191:119; Interrogation_Position=479; Antisense; AGCGGAGGAAGTTTCTTCAACTCAA
>probe:Drosophila_2:1633262_s_at:334:551; Interrogation_Position=507; Antisense; GGAGCGGAATTTCGCGCTTTGTTTT
>probe:Drosophila_2:1633262_s_at:327:693; Interrogation_Position=530; Antisense; TTTGTTTTGCCAAATTTGCCGCCGG
>probe:Drosophila_2:1633262_s_at:477:693; Interrogation_Position=544; Antisense; TTTGCCGCCGGCACACACGTGCTAT
>probe:Drosophila_2:1633262_s_at:533:133; Interrogation_Position=592; Antisense; ACCCAGTCTTTATGTGCGTTAACCG
>probe:Drosophila_2:1633262_s_at:589:321; Interrogation_Position=607; Antisense; GCGTTAACCGTTAAGTGTGCAGTTG
>probe:Drosophila_2:1633262_s_at:596:155; Interrogation_Position=730; Antisense; ACACACGCGGGACTTAACCCATTGA

Paste this into a BLAST search page for me
AAGCGCACGAGGCAACGCTCGAAAAGAAAAAGGAGCCAACGCAGCCGTTTAACGCAGCCGTTTACCGTTAGTCAGGTTAGTCAGCTGTTTACCGTTCCGCGTTCCGCCGCGAGATCGAAAACCGAGATCGAAAACCGAGAATTTTTGCCGAATCGCCGAAAAGCCGATAGTGCAAAGCGGAGGAAGTTTCTTCAACTCAAGGAGCGGAATTTCGCGCTTTGTTTTTTTGTTTTGCCAAATTTGCCGCCGGTTTGCCGCCGGCACACACGTGCTATACCCAGTCTTTATGTGCGTTAACCGGCGTTAACCGTTAAGTGTGCAGTTGACACACGCGGGACTTAACCCATTGA

Full Affymetrix probeset data:

Annotations for 1633262_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime