Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633263_at:

>probe:Drosophila_2:1633263_at:401:451; Interrogation_Position=1791; Antisense; GATCGAGGGCTTCAATCAGCCCGAA
>probe:Drosophila_2:1633263_at:445:239; Interrogation_Position=1804; Antisense; AATCAGCCCGAACTGGGTCCCAGTA
>probe:Drosophila_2:1633263_at:199:629; Interrogation_Position=1842; Antisense; TGCCAATGACATGAACCCCGAGGTG
>probe:Drosophila_2:1633263_at:448:303; Interrogation_Position=1884; Antisense; CCGCATGACCAGCAAGTACACGAAT
>probe:Drosophila_2:1633263_at:224:417; Interrogation_Position=1915; Antisense; GAGCGAATGCTCGTGATGCAGTCGA
>probe:Drosophila_2:1633263_at:671:53; Interrogation_Position=1930; Antisense; ATGCAGTCGAACGTCTGGCCAGGCG
>probe:Drosophila_2:1633263_at:209:323; Interrogation_Position=1952; Antisense; GCGCCTACACGTTCATCTTTGAGAA
>probe:Drosophila_2:1633263_at:92:131; Interrogation_Position=1978; Antisense; ACCTGCGAGTCGATATACTTGGGCT
>probe:Drosophila_2:1633263_at:625:243; Interrogation_Position=2026; Antisense; AATATTCCCTTCAAGCACTTGCCGA
>probe:Drosophila_2:1633263_at:684:199; Interrogation_Position=2074; Antisense; AACCCAGAGGACTTCGTCGAGGCCA
>probe:Drosophila_2:1633263_at:687:293; Interrogation_Position=2091; Antisense; CGAGGCCAACGATCCGACTGTCGAG
>probe:Drosophila_2:1633263_at:138:563; Interrogation_Position=2121; Antisense; GGAAGCTTACAAGGCTTGGCTCCTC
>probe:Drosophila_2:1633263_at:161:137; Interrogation_Position=2201; Antisense; ACGAGTTCGCCGATCAGTATGACGA
>probe:Drosophila_2:1633263_at:356:681; Interrogation_Position=2255; Antisense; TATGTTCTCATTCAAGTTCTGCAAT

Paste this into a BLAST search page for me
GATCGAGGGCTTCAATCAGCCCGAAAATCAGCCCGAACTGGGTCCCAGTATGCCAATGACATGAACCCCGAGGTGCCGCATGACCAGCAAGTACACGAATGAGCGAATGCTCGTGATGCAGTCGAATGCAGTCGAACGTCTGGCCAGGCGGCGCCTACACGTTCATCTTTGAGAAACCTGCGAGTCGATATACTTGGGCTAATATTCCCTTCAAGCACTTGCCGAAACCCAGAGGACTTCGTCGAGGCCACGAGGCCAACGATCCGACTGTCGAGGGAAGCTTACAAGGCTTGGCTCCTCACGAGTTCGCCGATCAGTATGACGATATGTTCTCATTCAAGTTCTGCAAT

Full Affymetrix probeset data:

Annotations for 1633263_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime