FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633264_at:

>probe:Drosophila_2:1633264_at:499:639; Interrogation_Position=1011; Antisense; TCGGATAATGCTGTACTTTCTGGTT
>probe:Drosophila_2:1633264_at:510:501; Interrogation_Position=511; Antisense; GTCGATCCCAACTTGCAGTATGTGA
>probe:Drosophila_2:1633264_at:455:27; Interrogation_Position=551; Antisense; ATACCGTATCCATCGCTAGCTCTAT
>probe:Drosophila_2:1633264_at:319:675; Interrogation_Position=567; Antisense; TAGCTCTATGCACTTCACGATGGTC
>probe:Drosophila_2:1633264_at:597:201; Interrogation_Position=617; Antisense; AACCGAAGCGCGGTCTATGCGATCG
>probe:Drosophila_2:1633264_at:652:267; Interrogation_Position=649; Antisense; CAGGTCACCGTGTTGATAGTCAGCA
>probe:Drosophila_2:1633264_at:676:57; Interrogation_Position=673; Antisense; ATGAGTACCATCTTCATGCTGCTCA
>probe:Drosophila_2:1633264_at:277:301; Interrogation_Position=732; Antisense; CCGTGACATGCCCAAGAGCTAGGAT
>probe:Drosophila_2:1633264_at:406:417; Interrogation_Position=747; Antisense; GAGCTAGGATTTAATACCCCTGCCT
>probe:Drosophila_2:1633264_at:9:689; Interrogation_Position=787; Antisense; TATTTATTGTATTGTCTTTGTCCCC
>probe:Drosophila_2:1633264_at:561:15; Interrogation_Position=828; Antisense; ATTATTGTTATCGTGTCGTCTTGGC
>probe:Drosophila_2:1633264_at:402:501; Interrogation_Position=842; Antisense; GTCGTCTTGGCGCTAGTTGTATAAG
>probe:Drosophila_2:1633264_at:626:709; Interrogation_Position=932; Antisense; TTAAGCGCGCTATGCTATGGAGACA
>probe:Drosophila_2:1633264_at:691:545; Interrogation_Position=987; Antisense; GGATCGGACAATAGCCGTCTGGTAT

Paste this into a BLAST search page for me
TCGGATAATGCTGTACTTTCTGGTTGTCGATCCCAACTTGCAGTATGTGAATACCGTATCCATCGCTAGCTCTATTAGCTCTATGCACTTCACGATGGTCAACCGAAGCGCGGTCTATGCGATCGCAGGTCACCGTGTTGATAGTCAGCAATGAGTACCATCTTCATGCTGCTCACCGTGACATGCCCAAGAGCTAGGATGAGCTAGGATTTAATACCCCTGCCTTATTTATTGTATTGTCTTTGTCCCCATTATTGTTATCGTGTCGTCTTGGCGTCGTCTTGGCGCTAGTTGTATAAGTTAAGCGCGCTATGCTATGGAGACAGGATCGGACAATAGCCGTCTGGTAT

Full Affymetrix probeset data:

Annotations for 1633264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720