Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633266_at:

>probe:Drosophila_2:1633266_at:127:479; Interrogation_Position=1017; Antisense; GTTTACTAATACCAATGCTGCGAAT
>probe:Drosophila_2:1633266_at:383:265; Interrogation_Position=1048; Antisense; CAGTATAATTCCTTCGATGCCGATC
>probe:Drosophila_2:1633266_at:682:453; Interrogation_Position=1117; Antisense; GATAGAGTCGTATATGTCAACCGGG
>probe:Drosophila_2:1633266_at:123:355; Interrogation_Position=1169; Antisense; GCACCATTTACATGATCGGTCGCAT
>probe:Drosophila_2:1633266_at:599:139; Interrogation_Position=1262; Antisense; ACGGCAGCCCTCTAAATGTCGGTTG
>probe:Drosophila_2:1633266_at:150:169; Interrogation_Position=1275; Antisense; AAATGTCGGTTGCTCTGCAGGACTC
>probe:Drosophila_2:1633266_at:385:349; Interrogation_Position=1291; Antisense; GCAGGACTCGAAATGCACGGCATTA
>probe:Drosophila_2:1633266_at:25:349; Interrogation_Position=1356; Antisense; GCAGTACACCGCTTTGATTTCGGGT
>probe:Drosophila_2:1633266_at:4:221; Interrogation_Position=794; Antisense; AAGTGCGCGGTGTTATGGTTCCATT
>probe:Drosophila_2:1633266_at:465:539; Interrogation_Position=843; Antisense; GGTATTACTGCCAAGGCCACGGTAT
>probe:Drosophila_2:1633266_at:689:311; Interrogation_Position=858; Antisense; GCCACGGTATTCCACGCAGCAAATA
>probe:Drosophila_2:1633266_at:188:375; Interrogation_Position=930; Antisense; GAAGACGCATCTCTTTTTGCCAAAA
>probe:Drosophila_2:1633266_at:574:517; Interrogation_Position=971; Antisense; GTGTGGATCTTAACATGGCCCTCAA
>probe:Drosophila_2:1633266_at:98:573; Interrogation_Position=987; Antisense; GGCCCTCAAGGCTTTGGGCATTCAA

Paste this into a BLAST search page for me
GTTTACTAATACCAATGCTGCGAATCAGTATAATTCCTTCGATGCCGATCGATAGAGTCGTATATGTCAACCGGGGCACCATTTACATGATCGGTCGCATACGGCAGCCCTCTAAATGTCGGTTGAAATGTCGGTTGCTCTGCAGGACTCGCAGGACTCGAAATGCACGGCATTAGCAGTACACCGCTTTGATTTCGGGTAAGTGCGCGGTGTTATGGTTCCATTGGTATTACTGCCAAGGCCACGGTATGCCACGGTATTCCACGCAGCAAATAGAAGACGCATCTCTTTTTGCCAAAAGTGTGGATCTTAACATGGCCCTCAAGGCCCTCAAGGCTTTGGGCATTCAA

Full Affymetrix probeset data:

Annotations for 1633266_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime