Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633267_a_at:

>probe:Drosophila_2:1633267_a_at:112:567; Interrogation_Position=1027; Antisense; GGCAAATTGGCGGACTCACTAGCTT
>probe:Drosophila_2:1633267_a_at:614:145; Interrogation_Position=1040; Antisense; ACTCACTAGCTTTGACGCCGAAGAA
>probe:Drosophila_2:1633267_a_at:464:641; Interrogation_Position=1082; Antisense; TCTGGGACCCCAAACTAGACATGTT
>probe:Drosophila_2:1633267_a_at:289:401; Interrogation_Position=1099; Antisense; GACATGTTTGCCCAGTTAACCGATT
>probe:Drosophila_2:1633267_a_at:365:199; Interrogation_Position=1116; Antisense; AACCGATTCCCAGCGAACGGATTTG
>probe:Drosophila_2:1633267_a_at:596:543; Interrogation_Position=1134; Antisense; GGATTTGTACAACCACTTCAGGAAG
>probe:Drosophila_2:1633267_a_at:185:161; Interrogation_Position=663; Antisense; ACAAGTGGTCTTGGCTCCGGAGCAA
>probe:Drosophila_2:1633267_a_at:593:509; Interrogation_Position=701; Antisense; GTGAAACGCTCTACTGGGATGCCAT
>probe:Drosophila_2:1633267_a_at:37:547; Interrogation_Position=717; Antisense; GGATGCCATACCGAAGCCCATGAAG
>probe:Drosophila_2:1633267_a_at:213:47; Interrogation_Position=762; Antisense; ATCCTTCACATCGTCCTTTTATGAG
>probe:Drosophila_2:1633267_a_at:422:103; Interrogation_Position=789; Antisense; AGAGCGCAGACTACTATACGGCAAG
>probe:Drosophila_2:1633267_a_at:570:69; Interrogation_Position=869; Antisense; AGGCCAACCTGAAGAGCTACCACAT
>probe:Drosophila_2:1633267_a_at:362:33; Interrogation_Position=892; Antisense; ATCAAGACGTTATTCCTGTGGCAGG
>probe:Drosophila_2:1633267_a_at:628:595; Interrogation_Position=987; Antisense; TGTGATGTCCACTGCTAACGTTCTA

Paste this into a BLAST search page for me
GGCAAATTGGCGGACTCACTAGCTTACTCACTAGCTTTGACGCCGAAGAATCTGGGACCCCAAACTAGACATGTTGACATGTTTGCCCAGTTAACCGATTAACCGATTCCCAGCGAACGGATTTGGGATTTGTACAACCACTTCAGGAAGACAAGTGGTCTTGGCTCCGGAGCAAGTGAAACGCTCTACTGGGATGCCATGGATGCCATACCGAAGCCCATGAAGATCCTTCACATCGTCCTTTTATGAGAGAGCGCAGACTACTATACGGCAAGAGGCCAACCTGAAGAGCTACCACATATCAAGACGTTATTCCTGTGGCAGGTGTGATGTCCACTGCTAACGTTCTA

Full Affymetrix probeset data:

Annotations for 1633267_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime