Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633269_at:

>probe:Drosophila_2:1633269_at:65:225; Interrogation_Position=1016; Antisense; AAGGAGTTGATTGAGCGCCACTGCG
>probe:Drosophila_2:1633269_at:543:529; Interrogation_Position=1059; Antisense; GGGATAATCTGCTAGGCGTCATTCC
>probe:Drosophila_2:1633269_at:553:283; Interrogation_Position=1120; Antisense; CTGCGACGATGTTATCATGGACTTC
>probe:Drosophila_2:1633269_at:420:267; Interrogation_Position=1135; Antisense; CATGGACTTCGATGGCCTAATTGCC
>probe:Drosophila_2:1633269_at:19:655; Interrogation_Position=1152; Antisense; TAATTGCCGCTCAGACTTCGCTGGG
>probe:Drosophila_2:1633269_at:268:539; Interrogation_Position=1175; Antisense; GGTACTGCGGCTATCATCGTAATGG
>probe:Drosophila_2:1633269_at:358:9; Interrogation_Position=1226; Antisense; ATTGCCAGGCTAATTTCATTCTATA
>probe:Drosophila_2:1633269_at:82:271; Interrogation_Position=1253; Antisense; CATGAGAGCTGTGGCCAGTGCACGC
>probe:Drosophila_2:1633269_at:384:279; Interrogation_Position=1317; Antisense; CTCGATTTGTTAAGGGTGACGCCCA
>probe:Drosophila_2:1633269_at:569:527; Interrogation_Position=1387; Antisense; GGGACACACTATTTGTGCGCTTGGT
>probe:Drosophila_2:1633269_at:204:717; Interrogation_Position=1451; Antisense; TTCCGGCCCGAGATCGAGAAACGTA
>probe:Drosophila_2:1633269_at:424:195; Interrogation_Position=1479; Antisense; AACTGCATGCAAAGCGCGTCAGCAA
>probe:Drosophila_2:1633269_at:392:459; Interrogation_Position=1534; Antisense; GATTTCATTAACCAGAGCGCGACTT
>probe:Drosophila_2:1633269_at:524:265; Interrogation_Position=1546; Antisense; CAGAGCGCGACTTGATGCCTATAAA

Paste this into a BLAST search page for me
AAGGAGTTGATTGAGCGCCACTGCGGGGATAATCTGCTAGGCGTCATTCCCTGCGACGATGTTATCATGGACTTCCATGGACTTCGATGGCCTAATTGCCTAATTGCCGCTCAGACTTCGCTGGGGGTACTGCGGCTATCATCGTAATGGATTGCCAGGCTAATTTCATTCTATACATGAGAGCTGTGGCCAGTGCACGCCTCGATTTGTTAAGGGTGACGCCCAGGGACACACTATTTGTGCGCTTGGTTTCCGGCCCGAGATCGAGAAACGTAAACTGCATGCAAAGCGCGTCAGCAAGATTTCATTAACCAGAGCGCGACTTCAGAGCGCGACTTGATGCCTATAAA

Full Affymetrix probeset data:

Annotations for 1633269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime