FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633271_at:

>probe:Drosophila_2:1633271_at:227:125; Interrogation_Position=522; Antisense; AGCCGCTTTCAAGGCATTGGGCTCA
>probe:Drosophila_2:1633271_at:277:5; Interrogation_Position=537; Antisense; ATTGGGCTCACTGGGCGGATACTTA
>probe:Drosophila_2:1633271_at:80:423; Interrogation_Position=582; Antisense; GAGACAGGGCCAAGTCACCTGGGCT
>probe:Drosophila_2:1633271_at:422:723; Interrogation_Position=621; Antisense; TTGCTCGTTCCGCATCGATGAACAG
>probe:Drosophila_2:1633271_at:155:147; Interrogation_Position=669; Antisense; ACTCTCTGGCTGTTTCGATTCAAGA
>probe:Drosophila_2:1633271_at:98:653; Interrogation_Position=688; Antisense; TCAAGACTGCGCGAAAGGTTCAGCT
>probe:Drosophila_2:1633271_at:154:79; Interrogation_Position=703; Antisense; AGGTTCAGCTTATGGCTTTTCGCTT
>probe:Drosophila_2:1633271_at:654:701; Interrogation_Position=719; Antisense; TTTTCGCTTTTTGGCCTTATGCACG
>probe:Drosophila_2:1633271_at:668:729; Interrogation_Position=729; Antisense; TTGGCCTTATGCACGGGCTCTGAAG
>probe:Drosophila_2:1633271_at:620:369; Interrogation_Position=750; Antisense; GAAGGCAGAGACACCTCAGTTCGGT
>probe:Drosophila_2:1633271_at:569:615; Interrogation_Position=765; Antisense; TCAGTTCGGTTCACAATCTCCCAGC
>probe:Drosophila_2:1633271_at:197:719; Interrogation_Position=827; Antisense; TTCGCGAGAGCGTCGATCGGTCGTC
>probe:Drosophila_2:1633271_at:645:41; Interrogation_Position=842; Antisense; ATCGGTCGTCGAGTTCAGTTGGCCT
>probe:Drosophila_2:1633271_at:223:503; Interrogation_Position=993; Antisense; GTCCCCGGGCTACATCAGTAGCAGT

Paste this into a BLAST search page for me
AGCCGCTTTCAAGGCATTGGGCTCAATTGGGCTCACTGGGCGGATACTTAGAGACAGGGCCAAGTCACCTGGGCTTTGCTCGTTCCGCATCGATGAACAGACTCTCTGGCTGTTTCGATTCAAGATCAAGACTGCGCGAAAGGTTCAGCTAGGTTCAGCTTATGGCTTTTCGCTTTTTTCGCTTTTTGGCCTTATGCACGTTGGCCTTATGCACGGGCTCTGAAGGAAGGCAGAGACACCTCAGTTCGGTTCAGTTCGGTTCACAATCTCCCAGCTTCGCGAGAGCGTCGATCGGTCGTCATCGGTCGTCGAGTTCAGTTGGCCTGTCCCCGGGCTACATCAGTAGCAGT

Full Affymetrix probeset data:

Annotations for 1633271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720