FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633272_at:

>probe:Drosophila_2:1633272_at:610:667; Interrogation_Position=1008; Antisense; TACATTGCCGGCGTGTTCTGCGCCA
>probe:Drosophila_2:1633272_at:288:311; Interrogation_Position=1105; Antisense; CCAAGCAGCTGGGTTGGTCTGGATT
>probe:Drosophila_2:1633272_at:105:693; Interrogation_Position=1139; Antisense; TTTGGTGCCCAGGATCGTGATGATC
>probe:Drosophila_2:1633272_at:312:451; Interrogation_Position=1151; Antisense; GATCGTGATGATCGGCACATTGACC
>probe:Drosophila_2:1633272_at:728:669; Interrogation_Position=1194; Antisense; TACGATGCCGTCAAGGTGTTCCTGC
>probe:Drosophila_2:1633272_at:338:395; Interrogation_Position=1242; Antisense; GAAATGCCCGAGTCCCTGAAGAAGA
>probe:Drosophila_2:1633272_at:226:575; Interrogation_Position=1272; Antisense; GGCGTGACTGGCGAGCAGTAAACCA
>probe:Drosophila_2:1633272_at:96:283; Interrogation_Position=807; Antisense; CTGCCCAAGATGACCGCCCAGGAGG
>probe:Drosophila_2:1633272_at:717:75; Interrogation_Position=826; Antisense; AGGAGGGCGTGACCGCCTTCTACAA
>probe:Drosophila_2:1633272_at:64:715; Interrogation_Position=843; Antisense; TTCTACAAGGGCCTGGTGCCATTGT
>probe:Drosophila_2:1633272_at:174:535; Interrogation_Position=857; Antisense; GGTGCCATTGTGGATGCGCCAGATC
>probe:Drosophila_2:1633272_at:660:215; Interrogation_Position=897; Antisense; AAGTTCGCCTGCTTCGAGCGGACGC
>probe:Drosophila_2:1633272_at:58:261; Interrogation_Position=955; Antisense; CACGTGCCGATTGCACCAAGGGTGA
>probe:Drosophila_2:1633272_at:525:607; Interrogation_Position=977; Antisense; TGAGCAGTTGGTGGTGACCTTCGCC

Paste this into a BLAST search page for me
TACATTGCCGGCGTGTTCTGCGCCACCAAGCAGCTGGGTTGGTCTGGATTTTTGGTGCCCAGGATCGTGATGATCGATCGTGATGATCGGCACATTGACCTACGATGCCGTCAAGGTGTTCCTGCGAAATGCCCGAGTCCCTGAAGAAGAGGCGTGACTGGCGAGCAGTAAACCACTGCCCAAGATGACCGCCCAGGAGGAGGAGGGCGTGACCGCCTTCTACAATTCTACAAGGGCCTGGTGCCATTGTGGTGCCATTGTGGATGCGCCAGATCAAGTTCGCCTGCTTCGAGCGGACGCCACGTGCCGATTGCACCAAGGGTGATGAGCAGTTGGTGGTGACCTTCGCC

Full Affymetrix probeset data:

Annotations for 1633272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720