FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633273_at:

>probe:Drosophila_2:1633273_at:111:673; Interrogation_Position=113; Antisense; TACGCAATCGCCGTTCCAAGATCAA
>probe:Drosophila_2:1633273_at:693:57; Interrogation_Position=13; Antisense; ATGTCCAAAACTCCAAAGCCCTTGA
>probe:Drosophila_2:1633273_at:649:653; Interrogation_Position=134; Antisense; TCAAGGGCGTCGACAGTAAGCCTAA
>probe:Drosophila_2:1633273_at:145:493; Interrogation_Position=149; Antisense; GTAAGCCTAACCCACAGAGGACCAT
>probe:Drosophila_2:1633273_at:203:101; Interrogation_Position=164; Antisense; AGAGGACCATCAGCCACGTCAAGGA
>probe:Drosophila_2:1633273_at:171:259; Interrogation_Position=178; Antisense; CACGTCAAGGACTCAAGGGCTGTTC
>probe:Drosophila_2:1633273_at:666:403; Interrogation_Position=187; Antisense; GACTCAAGGGCTGTTCCGCAAAATG
>probe:Drosophila_2:1633273_at:637:613; Interrogation_Position=212; Antisense; TGAAGCCGGGCAAAGTAGCAGACAT
>probe:Drosophila_2:1633273_at:117:63; Interrogation_Position=266; Antisense; ATGTGGATCAGGTGACTAATTCCTA
>probe:Drosophila_2:1633273_at:326:205; Interrogation_Position=28; Antisense; AAGCCCTTGACGTCCAAGCGTAGGA
>probe:Drosophila_2:1633273_at:504:189; Interrogation_Position=43; Antisense; AAGCGTAGGACCTCGCCGGCAAGTC
>probe:Drosophila_2:1633273_at:532:583; Interrogation_Position=69; Antisense; TGGCTCCACGGTCCTGATTGAAAGC
>probe:Drosophila_2:1633273_at:499:465; Interrogation_Position=84; Antisense; GATTGAAAGCCCAACAACCTCGAGT
>probe:Drosophila_2:1633273_at:112:187; Interrogation_Position=96; Antisense; AACAACCTCGAGTGGCGTACGCAAT

Paste this into a BLAST search page for me
TACGCAATCGCCGTTCCAAGATCAAATGTCCAAAACTCCAAAGCCCTTGATCAAGGGCGTCGACAGTAAGCCTAAGTAAGCCTAACCCACAGAGGACCATAGAGGACCATCAGCCACGTCAAGGACACGTCAAGGACTCAAGGGCTGTTCGACTCAAGGGCTGTTCCGCAAAATGTGAAGCCGGGCAAAGTAGCAGACATATGTGGATCAGGTGACTAATTCCTAAAGCCCTTGACGTCCAAGCGTAGGAAAGCGTAGGACCTCGCCGGCAAGTCTGGCTCCACGGTCCTGATTGAAAGCGATTGAAAGCCCAACAACCTCGAGTAACAACCTCGAGTGGCGTACGCAAT

Full Affymetrix probeset data:

Annotations for 1633273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720