FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633274_at:

>probe:Drosophila_2:1633274_at:580:553; Interrogation_Position=1092; Antisense; GGACCTGCAGTCAACACAACCAGTG
>probe:Drosophila_2:1633274_at:362:121; Interrogation_Position=1127; Antisense; AGCGACGACGTCTAACGAATCTGTC
>probe:Drosophila_2:1633274_at:5:91; Interrogation_Position=1166; Antisense; AGTAGCGCCCGCAACATGATAGGTG
>probe:Drosophila_2:1633274_at:564:23; Interrogation_Position=1184; Antisense; ATAGGTGCTGCTGTGCAACGTTGTT
>probe:Drosophila_2:1633274_at:590:293; Interrogation_Position=1202; Antisense; CGTTGTTGATTCGTTTGGTCTTCAT
>probe:Drosophila_2:1633274_at:370:725; Interrogation_Position=1227; Antisense; TTGAATCGTATTTACTCACCCACTC
>probe:Drosophila_2:1633274_at:105:365; Interrogation_Position=1270; Antisense; GAAGAGGGCCCACATAACCTGCATT
>probe:Drosophila_2:1633274_at:730:31; Interrogation_Position=1283; Antisense; ATAACCTGCATTAGCTCTTAGCGAT
>probe:Drosophila_2:1633274_at:279:273; Interrogation_Position=1348; Antisense; CATATTGTCCATACGCATTGAGAAC
>probe:Drosophila_2:1633274_at:574:59; Interrogation_Position=1427; Antisense; ATGTACAATGTACCCTGTCGATTTT
>probe:Drosophila_2:1633274_at:289:301; Interrogation_Position=1439; Antisense; CCCTGTCGATTTTATGGTTTGCTAA
>probe:Drosophila_2:1633274_at:447:193; Interrogation_Position=921; Antisense; AACTCGGTTATCCAGATGTACAGCA
>probe:Drosophila_2:1633274_at:286:443; Interrogation_Position=935; Antisense; GATGTACAGCAGTCCGGAGCAACCG
>probe:Drosophila_2:1633274_at:513:565; Interrogation_Position=972; Antisense; GGCACCACGAACTCATTTAACACTG

Paste this into a BLAST search page for me
GGACCTGCAGTCAACACAACCAGTGAGCGACGACGTCTAACGAATCTGTCAGTAGCGCCCGCAACATGATAGGTGATAGGTGCTGCTGTGCAACGTTGTTCGTTGTTGATTCGTTTGGTCTTCATTTGAATCGTATTTACTCACCCACTCGAAGAGGGCCCACATAACCTGCATTATAACCTGCATTAGCTCTTAGCGATCATATTGTCCATACGCATTGAGAACATGTACAATGTACCCTGTCGATTTTCCCTGTCGATTTTATGGTTTGCTAAAACTCGGTTATCCAGATGTACAGCAGATGTACAGCAGTCCGGAGCAACCGGGCACCACGAACTCATTTAACACTG

Full Affymetrix probeset data:

Annotations for 1633274_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720