FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633275_at:

>probe:Drosophila_2:1633275_at:219:25; Interrogation_Position=221; Antisense; ATATGTACGACATTTTCCTGCCCAA
>probe:Drosophila_2:1633275_at:474:461; Interrogation_Position=255; Antisense; GATTTTCCAAGAGGCTGCTTTCAAC
>probe:Drosophila_2:1633275_at:87:379; Interrogation_Position=295; Antisense; GAAGCCATAGTCGTTGGTCGGGAAC
>probe:Drosophila_2:1633275_at:651:381; Interrogation_Position=316; Antisense; GAACGCACCATCATGATCCTCGAGG
>probe:Drosophila_2:1633275_at:317:365; Interrogation_Position=466; Antisense; GAATACGCCGCCAAATCTGTCGATG
>probe:Drosophila_2:1633275_at:595:387; Interrogation_Position=496; Antisense; GAAAAGGACCTGCAGACTCTGGTTC
>probe:Drosophila_2:1633275_at:419:105; Interrogation_Position=509; Antisense; AGACTCTGGTTCACGGCGATTGCTG
>probe:Drosophila_2:1633275_at:16:587; Interrogation_Position=532; Antisense; TGGACCACCAACATGATGTACCTGT
>probe:Drosophila_2:1633275_at:616:299; Interrogation_Position=589; Antisense; CCCGTTGACTTCCAGTTCAATACTT
>probe:Drosophila_2:1633275_at:582:401; Interrogation_Position=615; Antisense; GACATCTCCGGCAGTGGATTTGCAT
>probe:Drosophila_2:1633275_at:445:343; Interrogation_Position=636; Antisense; GCATTACTTCTTCAGTACTTCGTTG
>probe:Drosophila_2:1633275_at:485:159; Interrogation_Position=719; Antisense; AAATCACCTTGGAGGCACTTTCCTA
>probe:Drosophila_2:1633275_at:506:269; Interrogation_Position=753; Antisense; CATCCCCAGCCTAGTTAAGTATCAG
>probe:Drosophila_2:1633275_at:444:483; Interrogation_Position=771; Antisense; GTATCAGCTGCCAAATTTTCTTGTA

Paste this into a BLAST search page for me
ATATGTACGACATTTTCCTGCCCAAGATTTTCCAAGAGGCTGCTTTCAACGAAGCCATAGTCGTTGGTCGGGAACGAACGCACCATCATGATCCTCGAGGGAATACGCCGCCAAATCTGTCGATGGAAAAGGACCTGCAGACTCTGGTTCAGACTCTGGTTCACGGCGATTGCTGTGGACCACCAACATGATGTACCTGTCCCGTTGACTTCCAGTTCAATACTTGACATCTCCGGCAGTGGATTTGCATGCATTACTTCTTCAGTACTTCGTTGAAATCACCTTGGAGGCACTTTCCTACATCCCCAGCCTAGTTAAGTATCAGGTATCAGCTGCCAAATTTTCTTGTA

Full Affymetrix probeset data:

Annotations for 1633275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720