FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633277_at:

>probe:Drosophila_2:1633277_at:598:511; Interrogation_Position=120; Antisense; GTGACGCCGCCATTATGCAGATCTT
>probe:Drosophila_2:1633277_at:704:95; Interrogation_Position=138; Antisense; AGATCTTCGTGAAAACCCTCACCGG
>probe:Drosophila_2:1633277_at:32:131; Interrogation_Position=173; Antisense; ACCTTGGAGGTGGAGCCTTCTGACA
>probe:Drosophila_2:1633277_at:685:553; Interrogation_Position=184; Antisense; GGAGCCTTCTGACACCATCGAGAAT
>probe:Drosophila_2:1633277_at:323:621; Interrogation_Position=351; Antisense; TGCGTGGTGGTATCATTGAGCCCTC
>probe:Drosophila_2:1633277_at:97:283; Interrogation_Position=373; Antisense; CTCGCTCAGGATTCTGGCCCAGAAG
>probe:Drosophila_2:1633277_at:260:159; Interrogation_Position=399; Antisense; ACAACTGCGACAAGATGATCTGCCG
>probe:Drosophila_2:1633277_at:543:443; Interrogation_Position=412; Antisense; GATGATCTGCCGCAAGTGCTACGCC
>probe:Drosophila_2:1633277_at:679:505; Interrogation_Position=450; Antisense; GTGCCACCAACTGCCGCAAGAAGAA
>probe:Drosophila_2:1633277_at:473:105; Interrogation_Position=519; Antisense; AGACTATGATCATCCGTCGACGGTC
>probe:Drosophila_2:1633277_at:720:307; Interrogation_Position=543; Antisense; CCAGGCTGGTCTTTCTATCGACAAA
>probe:Drosophila_2:1633277_at:361:473; Interrogation_Position=629; Antisense; GTATTGCATTTGCTGCCAAGGCACA
>probe:Drosophila_2:1633277_at:658:225; Interrogation_Position=646; Antisense; AAGGCACAGCCTATTTACACCGTGT
>probe:Drosophila_2:1633277_at:717:25; Interrogation_Position=94; Antisense; ATAGCATTTGGTTGCACGTTTCCTC

Paste this into a BLAST search page for me
GTGACGCCGCCATTATGCAGATCTTAGATCTTCGTGAAAACCCTCACCGGACCTTGGAGGTGGAGCCTTCTGACAGGAGCCTTCTGACACCATCGAGAATTGCGTGGTGGTATCATTGAGCCCTCCTCGCTCAGGATTCTGGCCCAGAAGACAACTGCGACAAGATGATCTGCCGGATGATCTGCCGCAAGTGCTACGCCGTGCCACCAACTGCCGCAAGAAGAAAGACTATGATCATCCGTCGACGGTCCCAGGCTGGTCTTTCTATCGACAAAGTATTGCATTTGCTGCCAAGGCACAAAGGCACAGCCTATTTACACCGTGTATAGCATTTGGTTGCACGTTTCCTC

Full Affymetrix probeset data:

Annotations for 1633277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720