FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633278_at:

>probe:Drosophila_2:1633278_at:704:581; Interrogation_Position=129; Antisense; TGGCGAGGATTTCGAGTACGTCTTC
>probe:Drosophila_2:1633278_at:240:599; Interrogation_Position=14; Antisense; TGTCGAATGATGTGCAGGTCGCCCG
>probe:Drosophila_2:1633278_at:250:91; Interrogation_Position=143; Antisense; AGTACGTCTTCGGTAGCATTTCGCC
>probe:Drosophila_2:1633278_at:365:347; Interrogation_Position=188; Antisense; GCAGGCACTTGGTGGGATCCTCCGA
>probe:Drosophila_2:1633278_at:8:587; Interrogation_Position=215; Antisense; TGGACTCTCCGGAGCACACGCAGCG
>probe:Drosophila_2:1633278_at:620:511; Interrogation_Position=254; Antisense; GTGACAACAACATATCCAGCTGCTC
>probe:Drosophila_2:1633278_at:343:621; Interrogation_Position=274; Antisense; TGCTCCACGCTAGACATTGTCAACA
>probe:Drosophila_2:1633278_at:105:187; Interrogation_Position=295; Antisense; AACAAAGTGAGTAATGATGCCCGCA
>probe:Drosophila_2:1633278_at:537:447; Interrogation_Position=310; Antisense; GATGCCCGCACTGAGAGAAATAACT
>probe:Drosophila_2:1633278_at:202:313; Interrogation_Position=34; Antisense; GCCCGGGTGGCCAAGATAGCTACCG
>probe:Drosophila_2:1633278_at:576:215; Interrogation_Position=46; Antisense; AAGATAGCTACCGATGTGCCGCGTC
>probe:Drosophila_2:1633278_at:551:501; Interrogation_Position=68; Antisense; GTCGCAGTGGCAAGCAGCGTGACTC
>probe:Drosophila_2:1633278_at:346:121; Interrogation_Position=83; Antisense; AGCGTGACTCCAGCGGATTCCAGGG
>probe:Drosophila_2:1633278_at:62:465; Interrogation_Position=98; Antisense; GATTCCAGGGCAAGCACTCCGGCAG

Paste this into a BLAST search page for me
TGGCGAGGATTTCGAGTACGTCTTCTGTCGAATGATGTGCAGGTCGCCCGAGTACGTCTTCGGTAGCATTTCGCCGCAGGCACTTGGTGGGATCCTCCGATGGACTCTCCGGAGCACACGCAGCGGTGACAACAACATATCCAGCTGCTCTGCTCCACGCTAGACATTGTCAACAAACAAAGTGAGTAATGATGCCCGCAGATGCCCGCACTGAGAGAAATAACTGCCCGGGTGGCCAAGATAGCTACCGAAGATAGCTACCGATGTGCCGCGTCGTCGCAGTGGCAAGCAGCGTGACTCAGCGTGACTCCAGCGGATTCCAGGGGATTCCAGGGCAAGCACTCCGGCAG

Full Affymetrix probeset data:

Annotations for 1633278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720