Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633279_s_at:

>probe:Drosophila_2:1633279_s_at:703:681; Interrogation_Position=1012; Antisense; TATGCACTCAGGCAGTATTCCACCT
>probe:Drosophila_2:1633279_s_at:241:717; Interrogation_Position=1029; Antisense; TTCCACCTGGGAGCGATTGATTGAT
>probe:Drosophila_2:1633279_s_at:147:415; Interrogation_Position=526; Antisense; GACCAGGAGCGCAAGGTGTCCATCA
>probe:Drosophila_2:1633279_s_at:18:599; Interrogation_Position=542; Antisense; TGTCCATCACGTTCACTTTCAAGAA
>probe:Drosophila_2:1633279_s_at:605:573; Interrogation_Position=598; Antisense; GGCGGAGCCGAGTCGCAGCTAATCA
>probe:Drosophila_2:1633279_s_at:195:83; Interrogation_Position=626; Antisense; AGGGCAACGCCAAGGGAGTCTCCAT
>probe:Drosophila_2:1633279_s_at:560:215; Interrogation_Position=658; Antisense; AAGATCTCTGAGATGCCCTGCAGTT
>probe:Drosophila_2:1633279_s_at:249:655; Interrogation_Position=684; Antisense; TAATCTGGCATGTAGGGTCCTTCCC
>probe:Drosophila_2:1633279_s_at:663:91; Interrogation_Position=761; Antisense; AGTTGTGGGCACAGCTCAAGGAGCA
>probe:Drosophila_2:1633279_s_at:25:547; Interrogation_Position=780; Antisense; GGAGCATGGCCAGCTTAGCGAGCAT
>probe:Drosophila_2:1633279_s_at:594:227; Interrogation_Position=873; Antisense; AATGGCATCCCACGATCTGGAGTTT
>probe:Drosophila_2:1633279_s_at:579:563; Interrogation_Position=935; Antisense; GGAAGATGCAGACCCATACACGCTA
>probe:Drosophila_2:1633279_s_at:639:53; Interrogation_Position=977; Antisense; ATGACAGCGGTGATTCCGGTCCCAG
>probe:Drosophila_2:1633279_s_at:498:503; Interrogation_Position=995; Antisense; GTCCCAGGATCTGCGAGTATGCACT

Paste this into a BLAST search page for me
TATGCACTCAGGCAGTATTCCACCTTTCCACCTGGGAGCGATTGATTGATGACCAGGAGCGCAAGGTGTCCATCATGTCCATCACGTTCACTTTCAAGAAGGCGGAGCCGAGTCGCAGCTAATCAAGGGCAACGCCAAGGGAGTCTCCATAAGATCTCTGAGATGCCCTGCAGTTTAATCTGGCATGTAGGGTCCTTCCCAGTTGTGGGCACAGCTCAAGGAGCAGGAGCATGGCCAGCTTAGCGAGCATAATGGCATCCCACGATCTGGAGTTTGGAAGATGCAGACCCATACACGCTAATGACAGCGGTGATTCCGGTCCCAGGTCCCAGGATCTGCGAGTATGCACT

Full Affymetrix probeset data:

Annotations for 1633279_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime