FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633282_at:

>probe:Drosophila_2:1633282_at:223:535; Interrogation_Position=427; Antisense; GGTGACCCTGCTGCCGTCAGTGAAG
>probe:Drosophila_2:1633282_at:434:115; Interrogation_Position=450; Antisense; AGCCGCCTCCTACAAAACCGAGAAG
>probe:Drosophila_2:1633282_at:21:63; Interrogation_Position=486; Antisense; ATGTCCATGTTCACGTCCATTGGAG
>probe:Drosophila_2:1633282_at:495:423; Interrogation_Position=508; Antisense; GAGAACTCGACGTCGCATCGGAGGA
>probe:Drosophila_2:1633282_at:204:271; Interrogation_Position=523; Antisense; CATCGGAGGAAATGCTATCGCGCCT
>probe:Drosophila_2:1633282_at:349:37; Interrogation_Position=580; Antisense; ATCTTTTGTCCGTGCTGCGCGACCA
>probe:Drosophila_2:1633282_at:195:347; Interrogation_Position=605; Antisense; GCAGGCGGCCGCTTATCAAGGCTGC
>probe:Drosophila_2:1633282_at:122:609; Interrogation_Position=723; Antisense; TGAGTACCTGTACTGCGCCAATTGC
>probe:Drosophila_2:1633282_at:420:697; Interrogation_Position=754; Antisense; TTTCTGGGCATCTACAATCGCGAGA
>probe:Drosophila_2:1633282_at:202:173; Interrogation_Position=779; Antisense; AAAGCTGTGTGCAGCCCAGCAAGGA
>probe:Drosophila_2:1633282_at:473:89; Interrogation_Position=803; Antisense; AGTTTGTGTCCTGCAGCAAGTCGGT
>probe:Drosophila_2:1633282_at:683:207; Interrogation_Position=841; Antisense; AAGTGTCCAACTGAAAACCTGTGAA
>probe:Drosophila_2:1633282_at:89:73; Interrogation_Position=866; Antisense; AGGACTTTGAGTGGGCGTAGTACTT
>probe:Drosophila_2:1633282_at:42:249; Interrogation_Position=895; Antisense; AATTGGTTGTGTATACATCTGGCTA

Paste this into a BLAST search page for me
GGTGACCCTGCTGCCGTCAGTGAAGAGCCGCCTCCTACAAAACCGAGAAGATGTCCATGTTCACGTCCATTGGAGGAGAACTCGACGTCGCATCGGAGGACATCGGAGGAAATGCTATCGCGCCTATCTTTTGTCCGTGCTGCGCGACCAGCAGGCGGCCGCTTATCAAGGCTGCTGAGTACCTGTACTGCGCCAATTGCTTTCTGGGCATCTACAATCGCGAGAAAAGCTGTGTGCAGCCCAGCAAGGAAGTTTGTGTCCTGCAGCAAGTCGGTAAGTGTCCAACTGAAAACCTGTGAAAGGACTTTGAGTGGGCGTAGTACTTAATTGGTTGTGTATACATCTGGCTA

Full Affymetrix probeset data:

Annotations for 1633282_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720