FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633283_at:

>probe:Drosophila_2:1633283_at:401:537; Interrogation_Position=279; Antisense; GGTCTTCAAGTTCTGCCGAGGCAAG
>probe:Drosophila_2:1633283_at:670:515; Interrogation_Position=303; Antisense; GTGTCACAAGGCCTTTAAGCGCAAG
>probe:Drosophila_2:1633283_at:687:209; Interrogation_Position=328; Antisense; AAGAATCCCCGCAAGGTAGGATGGA
>probe:Drosophila_2:1633283_at:228:59; Interrogation_Position=348; Antisense; ATGGACGAAGGCGTACCGCAAGGCC
>probe:Drosophila_2:1633283_at:516:379; Interrogation_Position=414; Antisense; GAAGCGCCGCAACGTGCCCATGAAA
>probe:Drosophila_2:1633283_at:493:241; Interrogation_Position=437; Antisense; AATACAGCCGCGAGACCTGGCAGAA
>probe:Drosophila_2:1633283_at:166:315; Interrogation_Position=472; Antisense; GCCATCAAGCGGGTGACGGAGATTA
>probe:Drosophila_2:1633283_at:97:13; Interrogation_Position=493; Antisense; ATTAAGGAGAAACGCACCAGCCACT
>probe:Drosophila_2:1633283_at:84:149; Interrogation_Position=515; Antisense; ACTTTGTCATGGAGCGACTGCGCAA
>probe:Drosophila_2:1633283_at:276:221; Interrogation_Position=538; Antisense; AAGGGTCGCCAGGTCGAGATTCAGA
>probe:Drosophila_2:1633283_at:118:573; Interrogation_Position=617; Antisense; GGCTGAAGCAACGACGTGCCCAGGA
>probe:Drosophila_2:1633283_at:274:423; Interrogation_Position=685; Antisense; GAGAAGATCACCTACGTGGATGCAC
>probe:Drosophila_2:1633283_at:730:519; Interrogation_Position=700; Antisense; GTGGATGCACGCGAACTCGAGAAGA
>probe:Drosophila_2:1633283_at:404:545; Interrogation_Position=775; Antisense; GGACGAGTACGCTGATTTTTTCTTA

Paste this into a BLAST search page for me
GGTCTTCAAGTTCTGCCGAGGCAAGGTGTCACAAGGCCTTTAAGCGCAAGAAGAATCCCCGCAAGGTAGGATGGAATGGACGAAGGCGTACCGCAAGGCCGAAGCGCCGCAACGTGCCCATGAAAAATACAGCCGCGAGACCTGGCAGAAGCCATCAAGCGGGTGACGGAGATTAATTAAGGAGAAACGCACCAGCCACTACTTTGTCATGGAGCGACTGCGCAAAAGGGTCGCCAGGTCGAGATTCAGAGGCTGAAGCAACGACGTGCCCAGGAGAGAAGATCACCTACGTGGATGCACGTGGATGCACGCGAACTCGAGAAGAGGACGAGTACGCTGATTTTTTCTTA

Full Affymetrix probeset data:

Annotations for 1633283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720