Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633284_at:

>probe:Drosophila_2:1633284_at:351:75; Interrogation_Position=475; Antisense; AGGAGCTGCAACACCTGCGTAACAG
>probe:Drosophila_2:1633284_at:717:699; Interrogation_Position=520; Antisense; TTTATCGTGTGGAGGAGCGCCTGTC
>probe:Drosophila_2:1633284_at:682:593; Interrogation_Position=550; Antisense; TGGGCAACGTTATCGCCTGCAATGA
>probe:Drosophila_2:1633284_at:660:591; Interrogation_Position=586; Antisense; TGGTGCACCCGGATCTGGACAAGGA
>probe:Drosophila_2:1633284_at:366:97; Interrogation_Position=619; Antisense; AGATCATCGCGGACGTGCTCAAAGT
>probe:Drosophila_2:1633284_at:235:333; Interrogation_Position=635; Antisense; GCTCAAAGTAGAGGTCTTCCGCCAG
>probe:Drosophila_2:1633284_at:627:397; Interrogation_Position=669; Antisense; GACAACTCACTGGTGGGCTCTTACG
>probe:Drosophila_2:1633284_at:127:83; Interrogation_Position=709; Antisense; AGGGCGGCATGGTGCATCCCAAGAC
>probe:Drosophila_2:1633284_at:441:251; Interrogation_Position=728; Antisense; CAAGACGAGCATTCAGGACCAGGAC
>probe:Drosophila_2:1633284_at:362:583; Interrogation_Position=843; Antisense; TGGCTCTCCTTCGTGGGCATGAACA
>probe:Drosophila_2:1633284_at:315:97; Interrogation_Position=880; Antisense; AGATCTCCGTGATCGAGAGCGTCTT
>probe:Drosophila_2:1633284_at:614:417; Interrogation_Position=896; Antisense; GAGCGTCTTCAAGCTTAACCAGGCA
>probe:Drosophila_2:1633284_at:687:153; Interrogation_Position=930; Antisense; ACAGTGACGACCAAGCTGCGTGCGG
>probe:Drosophila_2:1633284_at:380:275; Interrogation_Position=984; Antisense; CTTTCCCCACTTTCTACTTGATATA

Paste this into a BLAST search page for me
AGGAGCTGCAACACCTGCGTAACAGTTTATCGTGTGGAGGAGCGCCTGTCTGGGCAACGTTATCGCCTGCAATGATGGTGCACCCGGATCTGGACAAGGAAGATCATCGCGGACGTGCTCAAAGTGCTCAAAGTAGAGGTCTTCCGCCAGGACAACTCACTGGTGGGCTCTTACGAGGGCGGCATGGTGCATCCCAAGACCAAGACGAGCATTCAGGACCAGGACTGGCTCTCCTTCGTGGGCATGAACAAGATCTCCGTGATCGAGAGCGTCTTGAGCGTCTTCAAGCTTAACCAGGCAACAGTGACGACCAAGCTGCGTGCGGCTTTCCCCACTTTCTACTTGATATA

Full Affymetrix probeset data:

Annotations for 1633284_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime