Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633285_at:

>probe:Drosophila_2:1633285_at:505:309; Interrogation_Position=1461; Antisense; GCCAATGGGTCCACCGTTATATACG
>probe:Drosophila_2:1633285_at:290:389; Interrogation_Position=1485; Antisense; GAAACAATATCGTCCTGTCTTGCCA
>probe:Drosophila_2:1633285_at:219:107; Interrogation_Position=1511; Antisense; AGAAACCTCAGACCAGCTGGGCTTC
>probe:Drosophila_2:1633285_at:543:217; Interrogation_Position=1551; Antisense; AAGTCGCACTTATTTGCCCGCCAAT
>probe:Drosophila_2:1633285_at:504:311; Interrogation_Position=1570; Antisense; GCCAATTCAGGCAATGTAGTCTCCA
>probe:Drosophila_2:1633285_at:303:485; Interrogation_Position=1585; Antisense; GTAGTCTCCAGTATTAGTGTCTCTA
>probe:Drosophila_2:1633285_at:139:497; Interrogation_Position=1603; Antisense; GTCTCTACAAATTCTGTGGGTCCTG
>probe:Drosophila_2:1633285_at:394:535; Interrogation_Position=1638; Antisense; GGTGCCAAAGGCCTATATTTTCAAC
>probe:Drosophila_2:1633285_at:95:689; Interrogation_Position=1653; Antisense; TATTTTCAACCAGCACAACGGCATA
>probe:Drosophila_2:1633285_at:365:707; Interrogation_Position=1680; Antisense; TTACGAGACAAGTGGTCCCCATCTA
>probe:Drosophila_2:1633285_at:173:615; Interrogation_Position=1763; Antisense; TGAATGCCCGCCAATCTGGGTGGTG
>probe:Drosophila_2:1633285_at:445:29; Interrogation_Position=1811; Antisense; ATAATCCTACACACGGTACTTGGGT
>probe:Drosophila_2:1633285_at:125:149; Interrogation_Position=1828; Antisense; ACTTGGGTATATTCTCACACACTCG
>probe:Drosophila_2:1633285_at:273:477; Interrogation_Position=2002; Antisense; GTTTACGCAATTTTCTTGAGCGGAA

Paste this into a BLAST search page for me
GCCAATGGGTCCACCGTTATATACGGAAACAATATCGTCCTGTCTTGCCAAGAAACCTCAGACCAGCTGGGCTTCAAGTCGCACTTATTTGCCCGCCAATGCCAATTCAGGCAATGTAGTCTCCAGTAGTCTCCAGTATTAGTGTCTCTAGTCTCTACAAATTCTGTGGGTCCTGGGTGCCAAAGGCCTATATTTTCAACTATTTTCAACCAGCACAACGGCATATTACGAGACAAGTGGTCCCCATCTATGAATGCCCGCCAATCTGGGTGGTGATAATCCTACACACGGTACTTGGGTACTTGGGTATATTCTCACACACTCGGTTTACGCAATTTTCTTGAGCGGAA

Full Affymetrix probeset data:

Annotations for 1633285_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime