FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633286_at:

>probe:Drosophila_2:1633286_at:230:689; Interrogation_Position=3038; Antisense; TTTGGCGTTGGCAAGCGGAACTCTT
>probe:Drosophila_2:1633286_at:156:645; Interrogation_Position=3148; Antisense; TCTAGAGCTGATACATTGATACATT
>probe:Drosophila_2:1633286_at:223:531; Interrogation_Position=3188; Antisense; GGGTGATATATTTTCCGCTGGTTTA
>probe:Drosophila_2:1633286_at:608:695; Interrogation_Position=3199; Antisense; TTTCCGCTGGTTTAGTATGATCATA
>probe:Drosophila_2:1633286_at:643:177; Interrogation_Position=3277; Antisense; AAACAGGAAGTTGGCGATATCGAAT
>probe:Drosophila_2:1633286_at:125:55; Interrogation_Position=3302; Antisense; ATGCAACTGCATATGCACATTATAT
>probe:Drosophila_2:1633286_at:414:31; Interrogation_Position=3334; Antisense; ATAACTGTATACACGTATGAACGTT
>probe:Drosophila_2:1633286_at:611:377; Interrogation_Position=3352; Antisense; GAACGTTGAACATCTACAAGTAGGT
>probe:Drosophila_2:1633286_at:139:537; Interrogation_Position=3374; Antisense; GGTACTTAGAGTTAAACGACAGCAA
>probe:Drosophila_2:1633286_at:53:113; Interrogation_Position=3394; Antisense; AGCAACAACAAATCGCATCGAGCTA
>probe:Drosophila_2:1633286_at:192:43; Interrogation_Position=3405; Antisense; ATCGCATCGAGCTAATGTTAATAAC
>probe:Drosophila_2:1633286_at:96:389; Interrogation_Position=3430; Antisense; GAAAAGCACTCACTCACATACAAAC
>probe:Drosophila_2:1633286_at:313:179; Interrogation_Position=3475; Antisense; AAACACAGCCGTAGTCGTGCACATG
>probe:Drosophila_2:1633286_at:384:485; Interrogation_Position=3485; Antisense; GTAGTCGTGCACATGCACAAACTGA

Paste this into a BLAST search page for me
TTTGGCGTTGGCAAGCGGAACTCTTTCTAGAGCTGATACATTGATACATTGGGTGATATATTTTCCGCTGGTTTATTTCCGCTGGTTTAGTATGATCATAAAACAGGAAGTTGGCGATATCGAATATGCAACTGCATATGCACATTATATATAACTGTATACACGTATGAACGTTGAACGTTGAACATCTACAAGTAGGTGGTACTTAGAGTTAAACGACAGCAAAGCAACAACAAATCGCATCGAGCTAATCGCATCGAGCTAATGTTAATAACGAAAAGCACTCACTCACATACAAACAAACACAGCCGTAGTCGTGCACATGGTAGTCGTGCACATGCACAAACTGA

Full Affymetrix probeset data:

Annotations for 1633286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720