FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633287_at:

>probe:Drosophila_2:1633287_at:238:473; Interrogation_Position=1047; Antisense; GTTCTTCTTGTTAGAGATGCTGCGC
>probe:Drosophila_2:1633287_at:552:429; Interrogation_Position=1161; Antisense; GAGTTACATAGTCAAGTCAGGCAAT
>probe:Drosophila_2:1633287_at:191:357; Interrogation_Position=1206; Antisense; GCAAATCCAACTCCAAACCGAAAGA
>probe:Drosophila_2:1633287_at:656:697; Interrogation_Position=1234; Antisense; TTTAGGCAACTGACTTATGGCGACA
>probe:Drosophila_2:1633287_at:498:485; Interrogation_Position=1269; Antisense; GTAGGTCGTATTCGGAACGGCTTCT
>probe:Drosophila_2:1633287_at:640:381; Interrogation_Position=1283; Antisense; GAACGGCTTCTTGTGAAATTCATTT
>probe:Drosophila_2:1633287_at:104:507; Interrogation_Position=762; Antisense; GTGCGCAGCCTATGCGTGAATCTGA
>probe:Drosophila_2:1633287_at:20:367; Interrogation_Position=779; Antisense; GAATCTGAGCGCTGCTGACATCAAA
>probe:Drosophila_2:1633287_at:478:381; Interrogation_Position=815; Antisense; GAACGTGGAAATCTTGCACTCGGAA
>probe:Drosophila_2:1633287_at:87:581; Interrogation_Position=857; Antisense; GGCCAATGCTAAAAAGCCCGCTGGA
>probe:Drosophila_2:1633287_at:194:83; Interrogation_Position=883; Antisense; AGGGCAAGGGCAAGGTCACTCTCCG
>probe:Drosophila_2:1633287_at:639:633; Interrogation_Position=902; Antisense; TCTCCGCACCGAAAACGACGACATT
>probe:Drosophila_2:1633287_at:71:267; Interrogation_Position=917; Antisense; CGACGACATTGACGGTTACCAAAAG
>probe:Drosophila_2:1633287_at:410:545; Interrogation_Position=987; Antisense; GGATCTATAAATGTAGCCCGCATAT

Paste this into a BLAST search page for me
GTTCTTCTTGTTAGAGATGCTGCGCGAGTTACATAGTCAAGTCAGGCAATGCAAATCCAACTCCAAACCGAAAGATTTAGGCAACTGACTTATGGCGACAGTAGGTCGTATTCGGAACGGCTTCTGAACGGCTTCTTGTGAAATTCATTTGTGCGCAGCCTATGCGTGAATCTGAGAATCTGAGCGCTGCTGACATCAAAGAACGTGGAAATCTTGCACTCGGAAGGCCAATGCTAAAAAGCCCGCTGGAAGGGCAAGGGCAAGGTCACTCTCCGTCTCCGCACCGAAAACGACGACATTCGACGACATTGACGGTTACCAAAAGGGATCTATAAATGTAGCCCGCATAT

Full Affymetrix probeset data:

Annotations for 1633287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720