FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633288_at:

>probe:Drosophila_2:1633288_at:663:277; Interrogation_Position=106; Antisense; CTATCGGGCAAAGTCCATGCTGCAT
>probe:Drosophila_2:1633288_at:490:525; Interrogation_Position=111; Antisense; GGGCAAAGTCCATGCTGCATCTCCT
>probe:Drosophila_2:1633288_at:632:491; Interrogation_Position=170; Antisense; GTAATCTAATAGTCCGTTACAACAA
>probe:Drosophila_2:1633288_at:720:41; Interrogation_Position=18; Antisense; ATGCGGCAATTCCTTAAACAACAAC
>probe:Drosophila_2:1633288_at:177:475; Interrogation_Position=185; Antisense; GTTACAACAAACTAAGCTCGGGCAG
>probe:Drosophila_2:1633288_at:190:63; Interrogation_Position=310; Antisense; ATGTCCACAAACATGGCCACAAATG
>probe:Drosophila_2:1633288_at:299:311; Interrogation_Position=325; Antisense; GCCACAAATGGCCATCAGTTGTATC
>probe:Drosophila_2:1633288_at:215:579; Interrogation_Position=334; Antisense; GGCCATCAGTTGTATCCGGCGATAA
>probe:Drosophila_2:1633288_at:607:697; Interrogation_Position=343; Antisense; TTGTATCCGGCGATAACGGCAACGT
>probe:Drosophila_2:1633288_at:493:29; Interrogation_Position=355; Antisense; ATAACGGCAACGTATTGGCTCCCGC
>probe:Drosophila_2:1633288_at:647:365; Interrogation_Position=384; Antisense; GAATCCGGCGCCATATTTAGTTCCA
>probe:Drosophila_2:1633288_at:462:577; Interrogation_Position=390; Antisense; GGCGCCATATTTAGTTCCAGGTAAT
>probe:Drosophila_2:1633288_at:290:275; Interrogation_Position=45; Antisense; CATTGGCGGCAATATCAACGGAAAC
>probe:Drosophila_2:1633288_at:335:393; Interrogation_Position=77; Antisense; GAAATGGCGGAGTCAGCGAACAACG

Paste this into a BLAST search page for me
CTATCGGGCAAAGTCCATGCTGCATGGGCAAAGTCCATGCTGCATCTCCTGTAATCTAATAGTCCGTTACAACAAATGCGGCAATTCCTTAAACAACAACGTTACAACAAACTAAGCTCGGGCAGATGTCCACAAACATGGCCACAAATGGCCACAAATGGCCATCAGTTGTATCGGCCATCAGTTGTATCCGGCGATAATTGTATCCGGCGATAACGGCAACGTATAACGGCAACGTATTGGCTCCCGCGAATCCGGCGCCATATTTAGTTCCAGGCGCCATATTTAGTTCCAGGTAATCATTGGCGGCAATATCAACGGAAACGAAATGGCGGAGTCAGCGAACAACG

Full Affymetrix probeset data:

Annotations for 1633288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720