FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633289_at:

>probe:Drosophila_2:1633289_at:156:33; Interrogation_Position=1057; Antisense; ATAATCATTATCAGGGCGCAGCAGC
>probe:Drosophila_2:1633289_at:388:55; Interrogation_Position=1141; Antisense; ATGAGCGTCTCCTACCGGGTTATAA
>probe:Drosophila_2:1633289_at:227:191; Interrogation_Position=616; Antisense; AACATTGGCGCGGATATCTGGCTGC
>probe:Drosophila_2:1633289_at:684:39; Interrogation_Position=631; Antisense; ATCTGGCTGCTGTACTTTCAGGTGC
>probe:Drosophila_2:1633289_at:245:525; Interrogation_Position=675; Antisense; GGGCATTATACGATCACTGGCGGAT
>probe:Drosophila_2:1633289_at:553:267; Interrogation_Position=763; Antisense; CAGGTGCACCTGGTCAGTTTGCAAA
>probe:Drosophila_2:1633289_at:84:561; Interrogation_Position=808; Antisense; GGAAAATCGCTGCTTCTAAGCCTGC
>probe:Drosophila_2:1633289_at:379:575; Interrogation_Position=861; Antisense; GGCGGTGTACACTCTGATTCAGGGT
>probe:Drosophila_2:1633289_at:42:589; Interrogation_Position=893; Antisense; TGGAGGGCTTCACCTATGTGATCTT
>probe:Drosophila_2:1633289_at:425:63; Interrogation_Position=908; Antisense; ATGTGATCTTCATCGGGACTTCTGT
>probe:Drosophila_2:1633289_at:125:403; Interrogation_Position=924; Antisense; GACTTCTGTGATGCAGGTCTACCTG
>probe:Drosophila_2:1633289_at:79:497; Interrogation_Position=940; Antisense; GTCTACCTGGTGTGCTATTACGGTC
>probe:Drosophila_2:1633289_at:449:13; Interrogation_Position=956; Antisense; ATTACGGTCAGCAAGTTCTCGACTT
>probe:Drosophila_2:1633289_at:263:301; Interrogation_Position=995; Antisense; CCCACGCCGTGTACAATCATGATTT

Paste this into a BLAST search page for me
ATAATCATTATCAGGGCGCAGCAGCATGAGCGTCTCCTACCGGGTTATAAAACATTGGCGCGGATATCTGGCTGCATCTGGCTGCTGTACTTTCAGGTGCGGGCATTATACGATCACTGGCGGATCAGGTGCACCTGGTCAGTTTGCAAAGGAAAATCGCTGCTTCTAAGCCTGCGGCGGTGTACACTCTGATTCAGGGTTGGAGGGCTTCACCTATGTGATCTTATGTGATCTTCATCGGGACTTCTGTGACTTCTGTGATGCAGGTCTACCTGGTCTACCTGGTGTGCTATTACGGTCATTACGGTCAGCAAGTTCTCGACTTCCCACGCCGTGTACAATCATGATTT

Full Affymetrix probeset data:

Annotations for 1633289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720