FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633291_at:

>probe:Drosophila_2:1633291_at:116:723; Interrogation_Position=3381; Antisense; TTGTTTCTATCATTTCTACACTCCC
>probe:Drosophila_2:1633291_at:448:633; Interrogation_Position=3402; Antisense; TCCCTCCTTGGTGGCAGTGCGATAA
>probe:Drosophila_2:1633291_at:397:477; Interrogation_Position=3445; Antisense; GTTTAAGCCTAGGTTCTATTTCATG
>probe:Drosophila_2:1633291_at:230:141; Interrogation_Position=3474; Antisense; ACGGTGCTAAGCCATGATCAGCCCA
>probe:Drosophila_2:1633291_at:241:125; Interrogation_Position=3493; Antisense; AGCCCACATCATACTCGTACATATA
>probe:Drosophila_2:1633291_at:215:397; Interrogation_Position=3527; Antisense; GACAATCACTTGTAGCTTTCTTCAG
>probe:Drosophila_2:1633291_at:473:115; Interrogation_Position=3540; Antisense; AGCTTTCTTCAGCAGTTGAGCCGAT
>probe:Drosophila_2:1633291_at:140:487; Interrogation_Position=3612; Antisense; GTAGACACGCATACACGCACATTTT
>probe:Drosophila_2:1633291_at:47:105; Interrogation_Position=3738; Antisense; AGACTAAGCCGAATACTTCTGCGTC
>probe:Drosophila_2:1633291_at:112:499; Interrogation_Position=3760; Antisense; GTCCCACTGTCAGAGATTTTCCCAG
>probe:Drosophila_2:1633291_at:265:679; Interrogation_Position=3810; Antisense; TAGTACGCCCTATAGTCCACTTATT
>probe:Drosophila_2:1633291_at:204:29; Interrogation_Position=3852; Antisense; ATACATATCGCATACATACCCACAT
>probe:Drosophila_2:1633291_at:380:13; Interrogation_Position=3867; Antisense; ATACCCACATATATACCGCCTTATA
>probe:Drosophila_2:1633291_at:54:699; Interrogation_Position=3907; Antisense; TTTTGTCTACTTTTGTAAGCCGAGC

Paste this into a BLAST search page for me
TTGTTTCTATCATTTCTACACTCCCTCCCTCCTTGGTGGCAGTGCGATAAGTTTAAGCCTAGGTTCTATTTCATGACGGTGCTAAGCCATGATCAGCCCAAGCCCACATCATACTCGTACATATAGACAATCACTTGTAGCTTTCTTCAGAGCTTTCTTCAGCAGTTGAGCCGATGTAGACACGCATACACGCACATTTTAGACTAAGCCGAATACTTCTGCGTCGTCCCACTGTCAGAGATTTTCCCAGTAGTACGCCCTATAGTCCACTTATTATACATATCGCATACATACCCACATATACCCACATATATACCGCCTTATATTTTGTCTACTTTTGTAAGCCGAGC

Full Affymetrix probeset data:

Annotations for 1633291_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720