Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633293_at:

>probe:Drosophila_2:1633293_at:132:455; Interrogation_Position=182; Antisense; GATCACCCTGTACTACGAAGCATTG
>probe:Drosophila_2:1633293_at:156:377; Interrogation_Position=198; Antisense; GAAGCATTGTGTCCCTACTGCATGG
>probe:Drosophila_2:1633293_at:588:669; Interrogation_Position=213; Antisense; TACTGCATGGAGTTCGTGACCACGC
>probe:Drosophila_2:1633293_at:668:441; Interrogation_Position=251; Antisense; GATGGTCCGTCAGGATCGACTTCCA
>probe:Drosophila_2:1633293_at:403:635; Interrogation_Position=266; Antisense; TCGACTTCCATTCACTGATCTTACG
>probe:Drosophila_2:1633293_at:456:453; Interrogation_Position=282; Antisense; GATCTTACGCTGGTTCCTTATGGAA
>probe:Drosophila_2:1633293_at:291:521; Interrogation_Position=374; Antisense; GTGGCACGCCTGCATACTGGAGCAC
>probe:Drosophila_2:1633293_at:23:589; Interrogation_Position=391; Antisense; TGGAGCACCATGACATTGCCCAATC
>probe:Drosophila_2:1633293_at:71:251; Interrogation_Position=419; Antisense; CAAGCTGATCGCCTGCATGATGAGG
>probe:Drosophila_2:1633293_at:332:507; Interrogation_Position=467; Antisense; GTGCGCTGACCACTATCAAATCGAC
>probe:Drosophila_2:1633293_at:623:175; Interrogation_Position=517; Antisense; AAACGCGACAGGTGAACGACATTCT
>probe:Drosophila_2:1633293_at:491:175; Interrogation_Position=559; Antisense; AAACGGCCAAGGTCTCATTTCAGGG
>probe:Drosophila_2:1633293_at:714:15; Interrogation_Position=575; Antisense; ATTTCAGGGAGTGCCAGCCGTAGCT
>probe:Drosophila_2:1633293_at:95:449; Interrogation_Position=651; Antisense; GATGCCATTTTTTGCGCCAAGTATA

Paste this into a BLAST search page for me
GATCACCCTGTACTACGAAGCATTGGAAGCATTGTGTCCCTACTGCATGGTACTGCATGGAGTTCGTGACCACGCGATGGTCCGTCAGGATCGACTTCCATCGACTTCCATTCACTGATCTTACGGATCTTACGCTGGTTCCTTATGGAAGTGGCACGCCTGCATACTGGAGCACTGGAGCACCATGACATTGCCCAATCCAAGCTGATCGCCTGCATGATGAGGGTGCGCTGACCACTATCAAATCGACAAACGCGACAGGTGAACGACATTCTAAACGGCCAAGGTCTCATTTCAGGGATTTCAGGGAGTGCCAGCCGTAGCTGATGCCATTTTTTGCGCCAAGTATA

Full Affymetrix probeset data:

Annotations for 1633293_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime