FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633294_at:

>probe:Drosophila_2:1633294_at:460:609; Interrogation_Position=1019; Antisense; TGACGTGCAGCTACGACAACTCGAT
>probe:Drosophila_2:1633294_at:415:225; Interrogation_Position=1108; Antisense; AAGGACAAGGCCATCACCATCCGAT
>probe:Drosophila_2:1633294_at:187:47; Interrogation_Position=1126; Antisense; ATCCGATGGCATCCGACCGAGTTCT
>probe:Drosophila_2:1633294_at:79:517; Interrogation_Position=1214; Antisense; GTGGTCCAATGTTCCGGTCCAGTGG
>probe:Drosophila_2:1633294_at:618:573; Interrogation_Position=1237; Antisense; GGCGGCTTTAAATTCGTTGTCGATA
>probe:Drosophila_2:1633294_at:349:467; Interrogation_Position=1252; Antisense; GTTGTCGATATTGTACTTCCGCAGA
>probe:Drosophila_2:1633294_at:369:603; Interrogation_Position=740; Antisense; TGTTCGTGTCGGGATCGCAGGATCA
>probe:Drosophila_2:1633294_at:271:29; Interrogation_Position=769; Antisense; ATACGTTTCTGGGATCTGCGAGTGA
>probe:Drosophila_2:1633294_at:221:369; Interrogation_Position=792; Antisense; GAATGTCTCTGTGAATACGCTGGAT
>probe:Drosophila_2:1633294_at:340:491; Interrogation_Position=853; Antisense; GTAACCGCGGTCTGTGTAGATCCCA
>probe:Drosophila_2:1633294_at:254:71; Interrogation_Position=883; Antisense; AGGCTGCTAGTCTCTGGGCACGCTG
>probe:Drosophila_2:1633294_at:490:489; Interrogation_Position=917; Antisense; GTACTCTGTACGACATCCGTGGCAA
>probe:Drosophila_2:1633294_at:591:643; Interrogation_Position=959; Antisense; TCTATCCGCACACCGCTGAAATAAG
>probe:Drosophila_2:1633294_at:482:395; Interrogation_Position=976; Antisense; GAAATAAGGTGCGTCCGATTCTCCC

Paste this into a BLAST search page for me
TGACGTGCAGCTACGACAACTCGATAAGGACAAGGCCATCACCATCCGATATCCGATGGCATCCGACCGAGTTCTGTGGTCCAATGTTCCGGTCCAGTGGGGCGGCTTTAAATTCGTTGTCGATAGTTGTCGATATTGTACTTCCGCAGATGTTCGTGTCGGGATCGCAGGATCAATACGTTTCTGGGATCTGCGAGTGAGAATGTCTCTGTGAATACGCTGGATGTAACCGCGGTCTGTGTAGATCCCAAGGCTGCTAGTCTCTGGGCACGCTGGTACTCTGTACGACATCCGTGGCAATCTATCCGCACACCGCTGAAATAAGGAAATAAGGTGCGTCCGATTCTCCC

Full Affymetrix probeset data:

Annotations for 1633294_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720