FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633296_at:

>probe:Drosophila_2:1633296_at:402:531; Interrogation_Position=1305; Antisense; GGGTGATCTATATCCGTTCACACGC
>probe:Drosophila_2:1633296_at:319:317; Interrogation_Position=1328; Antisense; GCCGGCCAATGTTCGTTGTGATCGA
>probe:Drosophila_2:1633296_at:38:727; Interrogation_Position=1343; Antisense; TTGTGATCGACTCGGACAACTCGTT
>probe:Drosophila_2:1633296_at:407:159; Interrogation_Position=1358; Antisense; ACAACTCGTTTGTCTTTCAGCACAT
>probe:Drosophila_2:1633296_at:683:355; Interrogation_Position=1377; Antisense; GCACATACCGCGCTATTTTGGCCAG
>probe:Drosophila_2:1633296_at:417:619; Interrogation_Position=1440; Antisense; TGCATTCCAGGCTGATGTCCAGCAT
>probe:Drosophila_2:1633296_at:36:37; Interrogation_Position=1463; Antisense; ATCATGGCTCGCTGTTTACGTTGTT
>probe:Drosophila_2:1633296_at:28:643; Interrogation_Position=1520; Antisense; TCTGCAACGTTGGAGACGTGCCCAT
>probe:Drosophila_2:1633296_at:282:437; Interrogation_Position=1553; Antisense; GGGAACGCTGCCAGACCTACGTGGA
>probe:Drosophila_2:1633296_at:278:671; Interrogation_Position=1570; Antisense; TACGTGGACCGCTTCATCACGGAGG
>probe:Drosophila_2:1633296_at:241:541; Interrogation_Position=1645; Antisense; GGTTTTATAGATTCCTCCTACGTGC
>probe:Drosophila_2:1633296_at:381:717; Interrogation_Position=1711; Antisense; TTCGTCTTCTGTGATGTGGTGCTTC
>probe:Drosophila_2:1633296_at:380:119; Interrogation_Position=1787; Antisense; AGCTGCCGGCGAACGAACTGCTGGA
>probe:Drosophila_2:1633296_at:180:599; Interrogation_Position=1823; Antisense; TGTCGCACATCATCTTTCAGCTGGC

Paste this into a BLAST search page for me
GGGTGATCTATATCCGTTCACACGCGCCGGCCAATGTTCGTTGTGATCGATTGTGATCGACTCGGACAACTCGTTACAACTCGTTTGTCTTTCAGCACATGCACATACCGCGCTATTTTGGCCAGTGCATTCCAGGCTGATGTCCAGCATATCATGGCTCGCTGTTTACGTTGTTTCTGCAACGTTGGAGACGTGCCCATGGGAACGCTGCCAGACCTACGTGGATACGTGGACCGCTTCATCACGGAGGGGTTTTATAGATTCCTCCTACGTGCTTCGTCTTCTGTGATGTGGTGCTTCAGCTGCCGGCGAACGAACTGCTGGATGTCGCACATCATCTTTCAGCTGGC

Full Affymetrix probeset data:

Annotations for 1633296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720