FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633297_at:

>probe:Drosophila_2:1633297_at:300:477; Interrogation_Position=564; Antisense; GTTTTTCAAGCGGATTCTGTTGAGC
>probe:Drosophila_2:1633297_at:427:463; Interrogation_Position=576; Antisense; GATTCTGTTGAGCTGGTCGTTTATA
>probe:Drosophila_2:1633297_at:227:331; Interrogation_Position=587; Antisense; GCTGGTCGTTTATAATTATGTTGCT
>probe:Drosophila_2:1633297_at:684:571; Interrogation_Position=623; Antisense; GGCTCATATTAAACTAAACGATCCA
>probe:Drosophila_2:1633297_at:188:273; Interrogation_Position=646; Antisense; CATTATTTTCCCTGTGGAGGCACAA
>probe:Drosophila_2:1633297_at:143:727; Interrogation_Position=673; Antisense; TTGTAGACAACAATCTCCAGCGGCT
>probe:Drosophila_2:1633297_at:349:569; Interrogation_Position=694; Antisense; GGCTCTTGGCCAAAAACGTACTCGA
>probe:Drosophila_2:1633297_at:424:485; Interrogation_Position=711; Antisense; GTACTCGAGGACTCCGCTGACTTTT
>probe:Drosophila_2:1633297_at:659:631; Interrogation_Position=723; Antisense; TCCGCTGACTTTTTCCCATTCCAAG
>probe:Drosophila_2:1633297_at:444:7; Interrogation_Position=754; Antisense; ATTCCGCAGCCAATTTTTGGGATGG
>probe:Drosophila_2:1633297_at:550:691; Interrogation_Position=769; Antisense; TTTGGGATGGCCAGCTTATTCACGT
>probe:Drosophila_2:1633297_at:652:577; Interrogation_Position=777; Antisense; GGCCAGCTTATTCACGTTGTTTTTG
>probe:Drosophila_2:1633297_at:109:261; Interrogation_Position=789; Antisense; CACGTTGTTTTTGCGCTAATGTAGG
>probe:Drosophila_2:1633297_at:276:209; Interrogation_Position=875; Antisense; AAGCAGGGATACATTCCATTCATAA

Paste this into a BLAST search page for me
GTTTTTCAAGCGGATTCTGTTGAGCGATTCTGTTGAGCTGGTCGTTTATAGCTGGTCGTTTATAATTATGTTGCTGGCTCATATTAAACTAAACGATCCACATTATTTTCCCTGTGGAGGCACAATTGTAGACAACAATCTCCAGCGGCTGGCTCTTGGCCAAAAACGTACTCGAGTACTCGAGGACTCCGCTGACTTTTTCCGCTGACTTTTTCCCATTCCAAGATTCCGCAGCCAATTTTTGGGATGGTTTGGGATGGCCAGCTTATTCACGTGGCCAGCTTATTCACGTTGTTTTTGCACGTTGTTTTTGCGCTAATGTAGGAAGCAGGGATACATTCCATTCATAA

Full Affymetrix probeset data:

Annotations for 1633297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720