FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633298_at:

>probe:Drosophila_2:1633298_at:650:651; Interrogation_Position=514; Antisense; TCAAGAATTTCCACCGATCAGCTAG
>probe:Drosophila_2:1633298_at:628:23; Interrogation_Position=573; Antisense; ATATCCCGCCCATTTTGTTCATCAA
>probe:Drosophila_2:1633298_at:53:437; Interrogation_Position=610; Antisense; GAGGATTCCAGCTGTGCCACTCGAA
>probe:Drosophila_2:1633298_at:485:145; Interrogation_Position=628; Antisense; ACTCGAAGACGATCCTTATCTGCTC
>probe:Drosophila_2:1633298_at:620:685; Interrogation_Position=644; Antisense; TATCTGCTCCAGCTATGCAACTTAG
>probe:Drosophila_2:1633298_at:445:57; Interrogation_Position=689; Antisense; ATGAGATCCAAACTCCGGAGCGGCG
>probe:Drosophila_2:1633298_at:637:179; Interrogation_Position=726; Antisense; AAACAAATCGCCATCGGATCTCGAC
>probe:Drosophila_2:1633298_at:210:599; Interrogation_Position=776; Antisense; TGTCCGATTCCATTGGCGAGATCTT
>probe:Drosophila_2:1633298_at:276:427; Interrogation_Position=793; Antisense; GAGATCTTCGGCACCAAGGACATCA
>probe:Drosophila_2:1633298_at:638:577; Interrogation_Position=839; Antisense; GGCCGCGTCAGTACATTTTGCTGGA
>probe:Drosophila_2:1633298_at:488:257; Interrogation_Position=878; Antisense; CACTGGCCACCATGTTGAACGTTGA
>probe:Drosophila_2:1633298_at:362:329; Interrogation_Position=920; Antisense; GCGTGCTGGATATCACTCAGGGCTT
>probe:Drosophila_2:1633298_at:609:81; Interrogation_Position=938; Antisense; AGGGCTTGAGCCACGAGCAAATCCT
>probe:Drosophila_2:1633298_at:54:357; Interrogation_Position=954; Antisense; GCAAATCCTGCGCTTTCCGATAAAA

Paste this into a BLAST search page for me
TCAAGAATTTCCACCGATCAGCTAGATATCCCGCCCATTTTGTTCATCAAGAGGATTCCAGCTGTGCCACTCGAAACTCGAAGACGATCCTTATCTGCTCTATCTGCTCCAGCTATGCAACTTAGATGAGATCCAAACTCCGGAGCGGCGAAACAAATCGCCATCGGATCTCGACTGTCCGATTCCATTGGCGAGATCTTGAGATCTTCGGCACCAAGGACATCAGGCCGCGTCAGTACATTTTGCTGGACACTGGCCACCATGTTGAACGTTGAGCGTGCTGGATATCACTCAGGGCTTAGGGCTTGAGCCACGAGCAAATCCTGCAAATCCTGCGCTTTCCGATAAAA

Full Affymetrix probeset data:

Annotations for 1633298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720