FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633299_at:

>probe:Drosophila_2:1633299_at:491:31; Interrogation_Position=2905; Antisense; ATAACGTATGTCTAAGTAATCCCAA
>probe:Drosophila_2:1633299_at:407:485; Interrogation_Position=2920; Antisense; GTAATCCCAAAATATCTGCAAGTTG
>probe:Drosophila_2:1633299_at:401:245; Interrogation_Position=2962; Antisense; AATTTTGAGAGATTAGGCGCCCTAA
>probe:Drosophila_2:1633299_at:39:323; Interrogation_Position=2978; Antisense; GCGCCCTAACTTCAAGAGCTCAGAA
>probe:Drosophila_2:1633299_at:639:607; Interrogation_Position=3007; Antisense; TGAAATAAAACCCAACTCCTATCTT
>probe:Drosophila_2:1633299_at:693:27; Interrogation_Position=3037; Antisense; ATACTTACATTTCAGTCCAATTAAC
>probe:Drosophila_2:1633299_at:291:429; Interrogation_Position=3089; Antisense; GAGTTCAGAAGGGTTCAGCTGCAGC
>probe:Drosophila_2:1633299_at:597:647; Interrogation_Position=3103; Antisense; TCAGCTGCAGCATAACGGGAAAGTC
>probe:Drosophila_2:1633299_at:386:655; Interrogation_Position=3236; Antisense; TAATCCCTAATCCTAGCGTATAGAG
>probe:Drosophila_2:1633299_at:285:669; Interrogation_Position=3249; Antisense; TAGCGTATAGAGCACCCAAATCCCT
>probe:Drosophila_2:1633299_at:106:695; Interrogation_Position=3288; Antisense; TTTTTACTAGCCCTAAGTCTTGAAG
>probe:Drosophila_2:1633299_at:246:371; Interrogation_Position=3309; Antisense; GAAGGATACTCGATAAAGCCGCACA
>probe:Drosophila_2:1633299_at:19:205; Interrogation_Position=3324; Antisense; AAGCCGCACAACTATCTATAAATAT
>probe:Drosophila_2:1633299_at:480:471; Interrogation_Position=3384; Antisense; GTTACTTTATGTGTGGGAATCTGCC

Paste this into a BLAST search page for me
ATAACGTATGTCTAAGTAATCCCAAGTAATCCCAAAATATCTGCAAGTTGAATTTTGAGAGATTAGGCGCCCTAAGCGCCCTAACTTCAAGAGCTCAGAATGAAATAAAACCCAACTCCTATCTTATACTTACATTTCAGTCCAATTAACGAGTTCAGAAGGGTTCAGCTGCAGCTCAGCTGCAGCATAACGGGAAAGTCTAATCCCTAATCCTAGCGTATAGAGTAGCGTATAGAGCACCCAAATCCCTTTTTTACTAGCCCTAAGTCTTGAAGGAAGGATACTCGATAAAGCCGCACAAAGCCGCACAACTATCTATAAATATGTTACTTTATGTGTGGGAATCTGCC

Full Affymetrix probeset data:

Annotations for 1633299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720