FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633300_at:

>probe:Drosophila_2:1633300_at:207:669; Interrogation_Position=1010; Antisense; TACGGCCCACTACGAGAGGAATGTT
>probe:Drosophila_2:1633300_at:561:625; Interrogation_Position=1065; Antisense; TGCCCTGGGCAAGTGGACGGATCTA
>probe:Drosophila_2:1633300_at:382:543; Interrogation_Position=1083; Antisense; GGATCTACCCACATTGGGCGCAAAG
>probe:Drosophila_2:1633300_at:612:153; Interrogation_Position=1113; Antisense; ACAGTGGCGAGTTCCGACCCAGAAA
>probe:Drosophila_2:1633300_at:342:615; Interrogation_Position=1139; Antisense; TGAAGGCGCCTCCAAATCAAGGTGT
>probe:Drosophila_2:1633300_at:308:195; Interrogation_Position=1199; Antisense; AACTGGCAGCCAACTTTAACAACCT
>probe:Drosophila_2:1633300_at:442:705; Interrogation_Position=1214; Antisense; TTAACAACCTTCAGATGTGGCCCAC
>probe:Drosophila_2:1633300_at:653:419; Interrogation_Position=1240; Antisense; GAGCAGGATCCCTACGAGCATTGGA
>probe:Drosophila_2:1633300_at:188:725; Interrogation_Position=1340; Antisense; TTGAGCCAGATGACCGACAGATGAT
>probe:Drosophila_2:1633300_at:496:455; Interrogation_Position=1362; Antisense; GATAAGTACAGAGGCGCGTCCCACG
>probe:Drosophila_2:1633300_at:713:455; Interrogation_Position=1435; Antisense; GATAACATATTTTCTGTGCCCACAG
>probe:Drosophila_2:1633300_at:201:121; Interrogation_Position=885; Antisense; AGCGTACTTTCTAGAATCCATCCGG
>probe:Drosophila_2:1633300_at:530:441; Interrogation_Position=929; Antisense; GATGGGCCTGCAGTGGCTACATATC
>probe:Drosophila_2:1633300_at:45:15; Interrogation_Position=949; Antisense; ATATCCTACCTCCTGGGAATGTGTC

Paste this into a BLAST search page for me
TACGGCCCACTACGAGAGGAATGTTTGCCCTGGGCAAGTGGACGGATCTAGGATCTACCCACATTGGGCGCAAAGACAGTGGCGAGTTCCGACCCAGAAATGAAGGCGCCTCCAAATCAAGGTGTAACTGGCAGCCAACTTTAACAACCTTTAACAACCTTCAGATGTGGCCCACGAGCAGGATCCCTACGAGCATTGGATTGAGCCAGATGACCGACAGATGATGATAAGTACAGAGGCGCGTCCCACGGATAACATATTTTCTGTGCCCACAGAGCGTACTTTCTAGAATCCATCCGGGATGGGCCTGCAGTGGCTACATATCATATCCTACCTCCTGGGAATGTGTC

Full Affymetrix probeset data:

Annotations for 1633300_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720