FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633301_at:

>probe:Drosophila_2:1633301_at:636:481; Interrogation_Position=1017; Antisense; GTATTCCAAGGCCATCAGCACAATT
>probe:Drosophila_2:1633301_at:573:235; Interrogation_Position=1050; Antisense; AATCTGCTGAGATGCGCTTGGTCGC
>probe:Drosophila_2:1633301_at:186:365; Interrogation_Position=1083; Antisense; GATAAAATAACATCGGGTTCCGCCG
>probe:Drosophila_2:1633301_at:99:301; Interrogation_Position=1103; Antisense; CGCCGATCGGCATGTCTATATTTGG
>probe:Drosophila_2:1633301_at:641:109; Interrogation_Position=1143; Antisense; AGAATTCTTTACAAGCTGCCCGGAC
>probe:Drosophila_2:1633301_at:457:515; Interrogation_Position=1177; Antisense; GTGTCAATGCCGTGGATTTCAGCCC
>probe:Drosophila_2:1633301_at:132:211; Interrogation_Position=1204; Antisense; AAGAACCCCTGATTCTATCTGGATC
>probe:Drosophila_2:1633301_at:567:563; Interrogation_Position=1302; Antisense; TGAAACCCACGTTACTTCTTAGATT
>probe:Drosophila_2:1633301_at:23:245; Interrogation_Position=815; Antisense; AATTAGCGGCGGGATCGACAACGAA
>probe:Drosophila_2:1633301_at:388:389; Interrogation_Position=859; Antisense; GAAAACAGGCTGTCTTGCACCATCT
>probe:Drosophila_2:1633301_at:89:261; Interrogation_Position=876; Antisense; CACCATCTGCGAGGGCATTCGGATA
>probe:Drosophila_2:1633301_at:175:669; Interrogation_Position=899; Antisense; TACGATTACCGGAATGTCCTTGTCC
>probe:Drosophila_2:1633301_at:100:49; Interrogation_Position=949; Antisense; ATGCCATGGATAACACCTTGAGGGT
>probe:Drosophila_2:1633301_at:662:591; Interrogation_Position=975; Antisense; TGGGACGTGAGACCTTATGCACCCG

Paste this into a BLAST search page for me
GTATTCCAAGGCCATCAGCACAATTAATCTGCTGAGATGCGCTTGGTCGCGATAAAATAACATCGGGTTCCGCCGCGCCGATCGGCATGTCTATATTTGGAGAATTCTTTACAAGCTGCCCGGACGTGTCAATGCCGTGGATTTCAGCCCAAGAACCCCTGATTCTATCTGGATCTGAAACCCACGTTACTTCTTAGATTAATTAGCGGCGGGATCGACAACGAAGAAAACAGGCTGTCTTGCACCATCTCACCATCTGCGAGGGCATTCGGATATACGATTACCGGAATGTCCTTGTCCATGCCATGGATAACACCTTGAGGGTTGGGACGTGAGACCTTATGCACCCG

Full Affymetrix probeset data:

Annotations for 1633301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720