FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633304_at:

>probe:Drosophila_2:1633304_at:634:571; Interrogation_Position=535; Antisense; GGCTCTGCCCGGTGTGGATGAACAT
>probe:Drosophila_2:1633304_at:487:547; Interrogation_Position=550; Antisense; GGATGAACATGCCACGGTGCTCACA
>probe:Drosophila_2:1633304_at:41:425; Interrogation_Position=581; Antisense; GAGACATCGTCGCAGGCGATTCACA
>probe:Drosophila_2:1633304_at:426:345; Interrogation_Position=637; Antisense; GCATCATCGACTGAGGGAGGCGCAA
>probe:Drosophila_2:1633304_at:431:253; Interrogation_Position=667; Antisense; CAAGCGGGCCGAAGATCTCAATCAG
>probe:Drosophila_2:1633304_at:260:475; Interrogation_Position=695; Antisense; GTTATGGTCTGGTCATCCCTGGAGA
>probe:Drosophila_2:1633304_at:445:551; Interrogation_Position=715; Antisense; GGAGACGGCCGCAGTCATCGTGATC
>probe:Drosophila_2:1633304_at:412:41; Interrogation_Position=731; Antisense; ATCGTGATCGGTCTCGTCCAGATTA
>probe:Drosophila_2:1633304_at:464:329; Interrogation_Position=760; Antisense; GCTGAGGAACTTCTTTACGGACCGA
>probe:Drosophila_2:1633304_at:44:477; Interrogation_Position=826; Antisense; GTTTCATTTTGGGATCTAGCTTAGT
>probe:Drosophila_2:1633304_at:179:277; Interrogation_Position=841; Antisense; CTAGCTTAGTTCAGAGCCCTCGGAT
>probe:Drosophila_2:1633304_at:194:441; Interrogation_Position=863; Antisense; GATGGAGAGGGTCTCCTCCAATACC
>probe:Drosophila_2:1633304_at:273:231; Interrogation_Position=908; Antisense; AATGTTGTCAATCTCGTCTTAGCCA
>probe:Drosophila_2:1633304_at:693:495; Interrogation_Position=923; Antisense; GTCTTAGCCACAACGTATTCATTAC

Paste this into a BLAST search page for me
GGCTCTGCCCGGTGTGGATGAACATGGATGAACATGCCACGGTGCTCACAGAGACATCGTCGCAGGCGATTCACAGCATCATCGACTGAGGGAGGCGCAACAAGCGGGCCGAAGATCTCAATCAGGTTATGGTCTGGTCATCCCTGGAGAGGAGACGGCCGCAGTCATCGTGATCATCGTGATCGGTCTCGTCCAGATTAGCTGAGGAACTTCTTTACGGACCGAGTTTCATTTTGGGATCTAGCTTAGTCTAGCTTAGTTCAGAGCCCTCGGATGATGGAGAGGGTCTCCTCCAATACCAATGTTGTCAATCTCGTCTTAGCCAGTCTTAGCCACAACGTATTCATTAC

Full Affymetrix probeset data:

Annotations for 1633304_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720