FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633305_at:

>probe:Drosophila_2:1633305_at:685:579; Interrogation_Position=106; Antisense; TGGCCTCCGCCGACTATGTGGTGAA
>probe:Drosophila_2:1633305_at:57:535; Interrogation_Position=125; Antisense; GGTGAAGAACCGACACGACATGCTG
>probe:Drosophila_2:1633305_at:684:579; Interrogation_Position=148; Antisense; TGGCCTACCGCGATGAGTGCGTCAA
>probe:Drosophila_2:1633305_at:442:635; Interrogation_Position=21; Antisense; TCGCTCGATCGCTGGAGGAATACAT
>probe:Drosophila_2:1633305_at:618:591; Interrogation_Position=216; Antisense; TGGGAGTACCCCAACGACGCCAAGA
>probe:Drosophila_2:1633305_at:132:33; Interrogation_Position=252; Antisense; ATCAAGTGCGTCTTCACCAAGTGGG
>probe:Drosophila_2:1633305_at:384:601; Interrogation_Position=280; Antisense; TGTTCGACGTCCAGAGCGGTTTCAA
>probe:Drosophila_2:1633305_at:340:587; Interrogation_Position=307; Antisense; TGGAGAACATCCACCAACAGCTGGT
>probe:Drosophila_2:1633305_at:240:447; Interrogation_Position=403; Antisense; GATCCAATGCCTGCGAGTGGGCCTA
>probe:Drosophila_2:1633305_at:446:423; Interrogation_Position=453; Antisense; GAGAACCTGGCCCAGATCCAGAAGA
>probe:Drosophila_2:1633305_at:367:1; Interrogation_Position=490; Antisense; AGGCCTAGTGGCTTAGGTCCTAGTT
>probe:Drosophila_2:1633305_at:729:717; Interrogation_Position=562; Antisense; TTCCCATACAAGTTCGAGCATTCCT
>probe:Drosophila_2:1633305_at:600:419; Interrogation_Position=577; Antisense; GAGCATTCCTTCTCGATTCAGTGGG
>probe:Drosophila_2:1633305_at:698:467; Interrogation_Position=81; Antisense; GTTGCCATCTGCGTGCTGATTGGAC

Paste this into a BLAST search page for me
TGGCCTCCGCCGACTATGTGGTGAAGGTGAAGAACCGACACGACATGCTGTGGCCTACCGCGATGAGTGCGTCAATCGCTCGATCGCTGGAGGAATACATTGGGAGTACCCCAACGACGCCAAGAATCAAGTGCGTCTTCACCAAGTGGGTGTTCGACGTCCAGAGCGGTTTCAATGGAGAACATCCACCAACAGCTGGTGATCCAATGCCTGCGAGTGGGCCTAGAGAACCTGGCCCAGATCCAGAAGAAGGCCTAGTGGCTTAGGTCCTAGTTTTCCCATACAAGTTCGAGCATTCCTGAGCATTCCTTCTCGATTCAGTGGGGTTGCCATCTGCGTGCTGATTGGAC

Full Affymetrix probeset data:

Annotations for 1633305_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720