FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633306_at:

>probe:Drosophila_2:1633306_at:527:681; Interrogation_Position=486; Antisense; TATGATTGCCTGTAATTGTATCTGC
>probe:Drosophila_2:1633306_at:620:7; Interrogation_Position=490; Antisense; ATTGCCTGTAATTGTATCTGCGGAC
>probe:Drosophila_2:1633306_at:378:721; Interrogation_Position=491; Antisense; TTGCCTGTAATTGTATCTGCGGACG
>probe:Drosophila_2:1633306_at:646:301; Interrogation_Position=752; Antisense; CCGCCGAGCTACATGCGTGCTAATT
>probe:Drosophila_2:1633306_at:476:317; Interrogation_Position=754; Antisense; GCCGAGCTACATGCGTGCTAATTGA
>probe:Drosophila_2:1633306_at:4:341; Interrogation_Position=759; Antisense; GCTACATGCGTGCTAATTGACCAGG
>probe:Drosophila_2:1633306_at:392:153; Interrogation_Position=762; Antisense; ACATGCGTGCTAATTGACCAGGCTG
>probe:Drosophila_2:1633306_at:655:51; Interrogation_Position=764; Antisense; ATGCGTGCTAATTGACCAGGCTGCA
>probe:Drosophila_2:1633306_at:418:329; Interrogation_Position=766; Antisense; GCGTGCTAATTGACCAGGCTGCAGC
>probe:Drosophila_2:1633306_at:665:71; Interrogation_Position=781; Antisense; AGGCTGCAGCTCAACGCTGCTCCAA
>probe:Drosophila_2:1633306_at:728:117; Interrogation_Position=788; Antisense; AGCTCAACGCTGCTCCAATCCGAAA
>probe:Drosophila_2:1633306_at:76:201; Interrogation_Position=793; Antisense; AACGCTGCTCCAATCCGAAATCCGA
>probe:Drosophila_2:1633306_at:311:629; Interrogation_Position=801; Antisense; TCCAATCCGAAATCCGAATACGAAT
>probe:Drosophila_2:1633306_at:23:165; Interrogation_Position=810; Antisense; AAATCCGAATACGAATCCGACTCCG

Paste this into a BLAST search page for me
TATGATTGCCTGTAATTGTATCTGCATTGCCTGTAATTGTATCTGCGGACTTGCCTGTAATTGTATCTGCGGACGCCGCCGAGCTACATGCGTGCTAATTGCCGAGCTACATGCGTGCTAATTGAGCTACATGCGTGCTAATTGACCAGGACATGCGTGCTAATTGACCAGGCTGATGCGTGCTAATTGACCAGGCTGCAGCGTGCTAATTGACCAGGCTGCAGCAGGCTGCAGCTCAACGCTGCTCCAAAGCTCAACGCTGCTCCAATCCGAAAAACGCTGCTCCAATCCGAAATCCGATCCAATCCGAAATCCGAATACGAATAAATCCGAATACGAATCCGACTCCG

Full Affymetrix probeset data:

Annotations for 1633306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720