FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633307_at:

>probe:Drosophila_2:1633307_at:221:267; Interrogation_Position=1026; Antisense; CAGTCGCCTGGTGAATTCACGCAAA
>probe:Drosophila_2:1633307_at:120:445; Interrogation_Position=1102; Antisense; GATGACTCCATACTCTATGCGGATG
>probe:Drosophila_2:1633307_at:682:419; Interrogation_Position=1156; Antisense; GAGCACGATCAGTTGGCGGGACCAA
>probe:Drosophila_2:1633307_at:78:527; Interrogation_Position=1173; Antisense; GGGACCAAGGTTTATTGCACCTGAC
>probe:Drosophila_2:1633307_at:258:523; Interrogation_Position=1201; Antisense; GTGGCCAACAATACGGACTATCGCA
>probe:Drosophila_2:1633307_at:192:557; Interrogation_Position=1215; Antisense; GGACTATCGCACCTTGGACGTTTAT
>probe:Drosophila_2:1633307_at:438:555; Interrogation_Position=1230; Antisense; GGACGTTTATCTCAAGCAGCTGGAT
>probe:Drosophila_2:1633307_at:572:459; Interrogation_Position=1255; Antisense; GATTTGGCCAAAAAGCTACCCACTG
>probe:Drosophila_2:1633307_at:363:583; Interrogation_Position=1280; Antisense; TGGCTCCCATTAGTGGTCTCAACAA
>probe:Drosophila_2:1633307_at:30:529; Interrogation_Position=1363; Antisense; GGGATCTTTGAGACCCGACTGGATA
>probe:Drosophila_2:1633307_at:67:453; Interrogation_Position=1384; Antisense; GATAGTCAAACTAAACCCTCGTCGT
>probe:Drosophila_2:1633307_at:84:101; Interrogation_Position=881; Antisense; AGAGGCGGCGCAACTTCCGGAATAA
>probe:Drosophila_2:1633307_at:24:35; Interrogation_Position=972; Antisense; ATCAGTGTTTTCAAGTGCCAATTCA
>probe:Drosophila_2:1633307_at:579:625; Interrogation_Position=987; Antisense; TGCCAATTCACTTGCGGAAACTTCC

Paste this into a BLAST search page for me
CAGTCGCCTGGTGAATTCACGCAAAGATGACTCCATACTCTATGCGGATGGAGCACGATCAGTTGGCGGGACCAAGGGACCAAGGTTTATTGCACCTGACGTGGCCAACAATACGGACTATCGCAGGACTATCGCACCTTGGACGTTTATGGACGTTTATCTCAAGCAGCTGGATGATTTGGCCAAAAAGCTACCCACTGTGGCTCCCATTAGTGGTCTCAACAAGGGATCTTTGAGACCCGACTGGATAGATAGTCAAACTAAACCCTCGTCGTAGAGGCGGCGCAACTTCCGGAATAAATCAGTGTTTTCAAGTGCCAATTCATGCCAATTCACTTGCGGAAACTTCC

Full Affymetrix probeset data:

Annotations for 1633307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720