FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633310_at:

>probe:Drosophila_2:1633310_at:544:17; Interrogation_Position=1009; Antisense; ATATTTTTGGGCACCGTCGAGGATC
>probe:Drosophila_2:1633310_at:241:437; Interrogation_Position=1027; Antisense; GAGGATCCTCCATACGATGAGCGAT
>probe:Drosophila_2:1633310_at:265:161; Interrogation_Position=1073; Antisense; ACAAGATGACCCAGGCGTATGCCAT
>probe:Drosophila_2:1633310_at:562:49; Interrogation_Position=1091; Antisense; ATGCCATGTGCGTTCTGGACTACGA
>probe:Drosophila_2:1633310_at:200:557; Interrogation_Position=1107; Antisense; GGACTACGAGTTCCATATCCTGGAC
>probe:Drosophila_2:1633310_at:505:51; Interrogation_Position=1243; Antisense; ATGCGGATGATGTACGGTTCTCGGA
>probe:Drosophila_2:1633310_at:517:541; Interrogation_Position=697; Antisense; GGATTGGTGCCCGACTATATGCATT
>probe:Drosophila_2:1633310_at:522:685; Interrogation_Position=712; Antisense; TATATGCATTTCCTTGGCCGCCAAG
>probe:Drosophila_2:1633310_at:63:309; Interrogation_Position=777; Antisense; CCATGTGCTGCGGATTTTCGAGGTA
>probe:Drosophila_2:1633310_at:228:69; Interrogation_Position=802; Antisense; ATGGCCAATGTATCTGTACCGAACA
>probe:Drosophila_2:1633310_at:564:217; Interrogation_Position=853; Antisense; AAGTCGGGCGAAGCTGTGCCATTTC
>probe:Drosophila_2:1633310_at:85:587; Interrogation_Position=881; Antisense; TGGACATCTGTGAGGCATGCCATAG
>probe:Drosophila_2:1633310_at:637:233; Interrogation_Position=931; Antisense; AATGCGAGCGTTGTCTCCAAGGAAC
>probe:Drosophila_2:1633310_at:625:369; Interrogation_Position=957; Antisense; GAATGTCTTCAATGTTGGCCACCGC

Paste this into a BLAST search page for me
ATATTTTTGGGCACCGTCGAGGATCGAGGATCCTCCATACGATGAGCGATACAAGATGACCCAGGCGTATGCCATATGCCATGTGCGTTCTGGACTACGAGGACTACGAGTTCCATATCCTGGACATGCGGATGATGTACGGTTCTCGGAGGATTGGTGCCCGACTATATGCATTTATATGCATTTCCTTGGCCGCCAAGCCATGTGCTGCGGATTTTCGAGGTAATGGCCAATGTATCTGTACCGAACAAAGTCGGGCGAAGCTGTGCCATTTCTGGACATCTGTGAGGCATGCCATAGAATGCGAGCGTTGTCTCCAAGGAACGAATGTCTTCAATGTTGGCCACCGC

Full Affymetrix probeset data:

Annotations for 1633310_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720