Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633311_at:

>probe:Drosophila_2:1633311_at:542:537; Interrogation_Position=1029; Antisense; GGTCAACCCATTTCCATAGAGTCAT
>probe:Drosophila_2:1633311_at:196:687; Interrogation_Position=1108; Antisense; TATTCCTGGGACACGATAAGTTCGA
>probe:Drosophila_2:1633311_at:293:317; Interrogation_Position=1135; Antisense; GCCTGTCGGCGGGATTTCGCATAAA
>probe:Drosophila_2:1633311_at:513:125; Interrogation_Position=1176; Antisense; AGCCTGTTCTCCGTGAACCGAGATG
>probe:Drosophila_2:1633311_at:520:553; Interrogation_Position=1301; Antisense; GGAGCTGAGACTCGAATCGCCCACA
>probe:Drosophila_2:1633311_at:391:635; Interrogation_Position=1317; Antisense; TCGCCCACACGCCAATTGGAGATGA
>probe:Drosophila_2:1633311_at:463:401; Interrogation_Position=1353; Antisense; GACATCAATTTGCAATCGCGGGCAG
>probe:Drosophila_2:1633311_at:14:215; Interrogation_Position=1387; Antisense; AAGTCGTGGCCCTGGAAGACGTCAA
>probe:Drosophila_2:1633311_at:244:213; Interrogation_Position=1402; Antisense; AAGACGTCAAGTTCCGAGCCCTCGA
>probe:Drosophila_2:1633311_at:694:429; Interrogation_Position=1443; Antisense; GAGTCCTCCAAGATACTTATGCCCA
>probe:Drosophila_2:1633311_at:331:173; Interrogation_Position=1507; Antisense; AAAGCAGGGATCACATGCACCGCGT
>probe:Drosophila_2:1633311_at:576:285; Interrogation_Position=1547; Antisense; CTGTTCCAATGGCAAGCTTTTCCTC
>probe:Drosophila_2:1633311_at:15:309; Interrogation_Position=1580; Antisense; CCACTCCATATGTGCCGGCGATGAT
>probe:Drosophila_2:1633311_at:595:575; Interrogation_Position=1596; Antisense; GGCGATGATTCCACGGTCTGCAGAT

Paste this into a BLAST search page for me
GGTCAACCCATTTCCATAGAGTCATTATTCCTGGGACACGATAAGTTCGAGCCTGTCGGCGGGATTTCGCATAAAAGCCTGTTCTCCGTGAACCGAGATGGGAGCTGAGACTCGAATCGCCCACATCGCCCACACGCCAATTGGAGATGAGACATCAATTTGCAATCGCGGGCAGAAGTCGTGGCCCTGGAAGACGTCAAAAGACGTCAAGTTCCGAGCCCTCGAGAGTCCTCCAAGATACTTATGCCCAAAAGCAGGGATCACATGCACCGCGTCTGTTCCAATGGCAAGCTTTTCCTCCCACTCCATATGTGCCGGCGATGATGGCGATGATTCCACGGTCTGCAGAT

Full Affymetrix probeset data:

Annotations for 1633311_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime