Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633312_at:

>probe:Drosophila_2:1633312_at:549:163; Interrogation_Position=1941; Antisense; AAATTTCAGCTTTTTCGACGCCAGC
>probe:Drosophila_2:1633312_at:611:689; Interrogation_Position=1971; Antisense; TTTGGACACCTCAAAGCTGAACCCG
>probe:Drosophila_2:1633312_at:13:169; Interrogation_Position=2000; Antisense; AAATGTCGCTCAATGCTTCTAGCCT
>probe:Drosophila_2:1633312_at:75:709; Interrogation_Position=2137; Antisense; TTACAAGGATTCTACGTCCGCGACG
>probe:Drosophila_2:1633312_at:687:169; Interrogation_Position=2173; Antisense; AAAGTGGCCCGGCAACTGTTGTACG
>probe:Drosophila_2:1633312_at:213:143; Interrogation_Position=2187; Antisense; ACTGTTGTACGCTCCGATGACGGAA
>probe:Drosophila_2:1633312_at:302:183; Interrogation_Position=2224; Antisense; AAAAGCTCCGGCCACGTTGAAATAT
>probe:Drosophila_2:1633312_at:236:613; Interrogation_Position=2250; Antisense; TGAAAATCTGGTTCCTCCGCGAGTT
>probe:Drosophila_2:1633312_at:233:721; Interrogation_Position=2274; Antisense; TTGCCTACGACCATTGGGCTCTATA
>probe:Drosophila_2:1633312_at:713:639; Interrogation_Position=2315; Antisense; TCGGTTGTTCGATGATCTTTGGACA
>probe:Drosophila_2:1633312_at:326:505; Interrogation_Position=2351; Antisense; GTGCCCCACTCCTGGGAATATTTAT
>probe:Drosophila_2:1633312_at:344:363; Interrogation_Position=2366; Antisense; GAATATTTATTCTGGCGACTGTGCT
>probe:Drosophila_2:1633312_at:570:13; Interrogation_Position=2391; Antisense; ATTAGTCTATATCATGCTGCAGGCA
>probe:Drosophila_2:1633312_at:341:333; Interrogation_Position=2406; Antisense; GCTGCAGGCATTGTTTTCCTAGTTT

Paste this into a BLAST search page for me
AAATTTCAGCTTTTTCGACGCCAGCTTTGGACACCTCAAAGCTGAACCCGAAATGTCGCTCAATGCTTCTAGCCTTTACAAGGATTCTACGTCCGCGACGAAAGTGGCCCGGCAACTGTTGTACGACTGTTGTACGCTCCGATGACGGAAAAAAGCTCCGGCCACGTTGAAATATTGAAAATCTGGTTCCTCCGCGAGTTTTGCCTACGACCATTGGGCTCTATATCGGTTGTTCGATGATCTTTGGACAGTGCCCCACTCCTGGGAATATTTATGAATATTTATTCTGGCGACTGTGCTATTAGTCTATATCATGCTGCAGGCAGCTGCAGGCATTGTTTTCCTAGTTT

Full Affymetrix probeset data:

Annotations for 1633312_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime