Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633313_at:

>probe:Drosophila_2:1633313_at:256:125; Interrogation_Position=6342; Antisense; AGCCGTTCAACGCATTTTCTTATTG
>probe:Drosophila_2:1633313_at:165:169; Interrogation_Position=6406; Antisense; AAAGGAAATCTTTGTGCTAGGCGTT
>probe:Drosophila_2:1633313_at:24:339; Interrogation_Position=6421; Antisense; GCTAGGCGTTGTAATGGTATACACC
>probe:Drosophila_2:1633313_at:420:539; Interrogation_Position=6436; Antisense; GGTATACACCTTTGCTTTTAATTTG
>probe:Drosophila_2:1633313_at:489:361; Interrogation_Position=6592; Antisense; GCAAGTGAAATGCTTTTAAAGTCTC
>probe:Drosophila_2:1633313_at:626:109; Interrogation_Position=6635; Antisense; AGCAAATTTTTTCGCTTGCATATTT
>probe:Drosophila_2:1633313_at:527:695; Interrogation_Position=6644; Antisense; TTTCGCTTGCATATTTTAACAGTGA
>probe:Drosophila_2:1633313_at:559:387; Interrogation_Position=6691; Antisense; GAAAACCAGTGCTTAGATCAAATTT
>probe:Drosophila_2:1633313_at:665:261; Interrogation_Position=6769; Antisense; CAGCCATAAAGTGTATCGCTAATTT
>probe:Drosophila_2:1633313_at:565:483; Interrogation_Position=6781; Antisense; GTATCGCTAATTTTCGTAATGCACA
>probe:Drosophila_2:1633313_at:590:493; Interrogation_Position=6796; Antisense; GTAATGCACATCTTGCGTGTACGAT
>probe:Drosophila_2:1633313_at:675:645; Interrogation_Position=6806; Antisense; TCTTGCGTGTACGATTATTCGTCAA
>probe:Drosophila_2:1633313_at:600:643; Interrogation_Position=6821; Antisense; TATTCGTCAAAAAACCTACTTATTG
>probe:Drosophila_2:1633313_at:686:175; Interrogation_Position=6855; Antisense; AAACGTTTTAGCATCACCACTGTAA

Paste this into a BLAST search page for me
AGCCGTTCAACGCATTTTCTTATTGAAAGGAAATCTTTGTGCTAGGCGTTGCTAGGCGTTGTAATGGTATACACCGGTATACACCTTTGCTTTTAATTTGGCAAGTGAAATGCTTTTAAAGTCTCAGCAAATTTTTTCGCTTGCATATTTTTTCGCTTGCATATTTTAACAGTGAGAAAACCAGTGCTTAGATCAAATTTCAGCCATAAAGTGTATCGCTAATTTGTATCGCTAATTTTCGTAATGCACAGTAATGCACATCTTGCGTGTACGATTCTTGCGTGTACGATTATTCGTCAATATTCGTCAAAAAACCTACTTATTGAAACGTTTTAGCATCACCACTGTAA

Full Affymetrix probeset data:

Annotations for 1633313_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime