Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633314_at:

>probe:Drosophila_2:1633314_at:142:423; Interrogation_Position=143; Antisense; GAGACGGCTCGATACTTTAGGGATT
>probe:Drosophila_2:1633314_at:66:513; Interrogation_Position=207; Antisense; TGGCCTACGTGGTTTTGTCTCGTCG
>probe:Drosophila_2:1633314_at:680:493; Interrogation_Position=223; Antisense; GTCTCGTCGCCCAAATTTGCAATTG
>probe:Drosophila_2:1633314_at:459:247; Interrogation_Position=243; Antisense; AATTGAAAGTTCCACTGTCCACTCA
>probe:Drosophila_2:1633314_at:65:95; Interrogation_Position=324; Antisense; AGTTGCTCTTCACCTGTGCTGCGAA
>probe:Drosophila_2:1633314_at:538:597; Interrogation_Position=338; Antisense; TGTGCTGCGAACTATCCACTCGCAA
>probe:Drosophila_2:1633314_at:40:205; Interrogation_Position=386; Antisense; AAGCGCAATGTGAGCGACGCCTTTG
>probe:Drosophila_2:1633314_at:308:133; Interrogation_Position=402; Antisense; ACGCCTTTGAGCAGGTTCTCCGCAA
>probe:Drosophila_2:1633314_at:412:281; Interrogation_Position=419; Antisense; CTCCGCAAAGAGATTGACCTGATTT
>probe:Drosophila_2:1633314_at:147:439; Interrogation_Position=446; Antisense; GAGGAACATCTTGGCCTCCAGATGA
>probe:Drosophila_2:1633314_at:534:307; Interrogation_Position=463; Antisense; CCAGATGATTGTGCCGGTGGTGACC
>probe:Drosophila_2:1633314_at:158:609; Interrogation_Position=483; Antisense; TGACCCGGCTACAAATCACGCTGAA
>probe:Drosophila_2:1633314_at:326:655; Interrogation_Position=537; Antisense; TAAGGTCACGCATAAGTTGTTTTTT
>probe:Drosophila_2:1633314_at:254:255; Interrogation_Position=62; Antisense; CAAAATTACCGGAGGATGGCGCAAA

Paste this into a BLAST search page for me
GAGACGGCTCGATACTTTAGGGATTTGGCCTACGTGGTTTTGTCTCGTCGGTCTCGTCGCCCAAATTTGCAATTGAATTGAAAGTTCCACTGTCCACTCAAGTTGCTCTTCACCTGTGCTGCGAATGTGCTGCGAACTATCCACTCGCAAAAGCGCAATGTGAGCGACGCCTTTGACGCCTTTGAGCAGGTTCTCCGCAACTCCGCAAAGAGATTGACCTGATTTGAGGAACATCTTGGCCTCCAGATGACCAGATGATTGTGCCGGTGGTGACCTGACCCGGCTACAAATCACGCTGAATAAGGTCACGCATAAGTTGTTTTTTCAAAATTACCGGAGGATGGCGCAAA

Full Affymetrix probeset data:

Annotations for 1633314_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime