Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633315_at:

>probe:Drosophila_2:1633315_at:664:399; Interrogation_Position=1316; Antisense; GACAGCTACTCACCAGCGAGGAGAG
>probe:Drosophila_2:1633315_at:420:425; Interrogation_Position=1336; Antisense; GAGAGCACAAATCCGGCGCCCAGGA
>probe:Drosophila_2:1633315_at:656:299; Interrogation_Position=1352; Antisense; CGCCCAGGATGTACACGGTCTGTGA
>probe:Drosophila_2:1633315_at:601:107; Interrogation_Position=1376; Antisense; AGAACTGCTGCACGAAGGCTCCGTA
>probe:Drosophila_2:1633315_at:634:101; Interrogation_Position=1400; Antisense; AGACGAGGCCCACAATTCCGAAGAA
>probe:Drosophila_2:1633315_at:122:197; Interrogation_Position=1423; Antisense; AACGTGATGATGAAGCGCGACCAGC
>probe:Drosophila_2:1633315_at:359:541; Interrogation_Position=1515; Antisense; GGTTGCGAAGCATACCTACCATATG
>probe:Drosophila_2:1633315_at:227:673; Interrogation_Position=1531; Antisense; TACCATATGCGTCTGGATGTCCAAC
>probe:Drosophila_2:1633315_at:514:509; Interrogation_Position=1561; Antisense; GTGCAATTCACAAGCTGCGATTCAA
>probe:Drosophila_2:1633315_at:473:185; Interrogation_Position=1600; Antisense; AACAATTTTCTTTTGCGGCACGTCA
>probe:Drosophila_2:1633315_at:397:63; Interrogation_Position=1633; Antisense; ATGGTGTGACCGTGCCGAGCGAAAA
>probe:Drosophila_2:1633315_at:174:385; Interrogation_Position=1690; Antisense; GAACTCGGTGAATTTCCCATTATTT
>probe:Drosophila_2:1633315_at:540:701; Interrogation_Position=1713; Antisense; TTTTGTACATGCTTATTTCCCTCTT
>probe:Drosophila_2:1633315_at:189:167; Interrogation_Position=1846; Antisense; AAATGATGTTTTCCTTTGCAGAGTA

Paste this into a BLAST search page for me
GACAGCTACTCACCAGCGAGGAGAGGAGAGCACAAATCCGGCGCCCAGGACGCCCAGGATGTACACGGTCTGTGAAGAACTGCTGCACGAAGGCTCCGTAAGACGAGGCCCACAATTCCGAAGAAAACGTGATGATGAAGCGCGACCAGCGGTTGCGAAGCATACCTACCATATGTACCATATGCGTCTGGATGTCCAACGTGCAATTCACAAGCTGCGATTCAAAACAATTTTCTTTTGCGGCACGTCAATGGTGTGACCGTGCCGAGCGAAAAGAACTCGGTGAATTTCCCATTATTTTTTTGTACATGCTTATTTCCCTCTTAAATGATGTTTTCCTTTGCAGAGTA

Full Affymetrix probeset data:

Annotations for 1633315_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime