FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633316_at:

>probe:Drosophila_2:1633316_at:699:429; Interrogation_Position=1049; Antisense; GAGTCAACGCTCGAGTACGTCGGTC
>probe:Drosophila_2:1633316_at:313:89; Interrogation_Position=1062; Antisense; AGTACGTCGGTCATTGCGCTGTGTG
>probe:Drosophila_2:1633316_at:722:285; Interrogation_Position=1080; Antisense; CTGTGTGTTGCACTTTGTCGGCTAA
>probe:Drosophila_2:1633316_at:500:193; Interrogation_Position=591; Antisense; AACTCACTCACCCATTCATATATTT
>probe:Drosophila_2:1633316_at:282:701; Interrogation_Position=620; Antisense; TTTTGTTTACATTGCCGGCTTGTGC
>probe:Drosophila_2:1633316_at:6:343; Interrogation_Position=637; Antisense; GCTTGTGCAGCCCAAACAACAACTG
>probe:Drosophila_2:1633316_at:625:727; Interrogation_Position=679; Antisense; TTGGGAAAGCCTTGTGACGTCACCG
>probe:Drosophila_2:1633316_at:366:139; Interrogation_Position=695; Antisense; ACGTCACCGGGAATGTGCGTGCTAT
>probe:Drosophila_2:1633316_at:40:563; Interrogation_Position=826; Antisense; GGAACTCGCAATTTGGCTGCTCATT
>probe:Drosophila_2:1633316_at:334:613; Interrogation_Position=872; Antisense; TGAAACTTCCGCAAAATGGCCGAGA
>probe:Drosophila_2:1633316_at:440:103; Interrogation_Position=930; Antisense; AGAGCGAGTTCGCAACGTCATCGGC
>probe:Drosophila_2:1633316_at:514:139; Interrogation_Position=944; Antisense; ACGTCATCGGCACAGCATCAACAAG
>probe:Drosophila_2:1633316_at:515:341; Interrogation_Position=968; Antisense; GCTTACTGGCTGCTAAAAATCGTCA
>probe:Drosophila_2:1633316_at:721:607; Interrogation_Position=999; Antisense; TGAGATCATTATTCCCATCGGCGAG

Paste this into a BLAST search page for me
GAGTCAACGCTCGAGTACGTCGGTCAGTACGTCGGTCATTGCGCTGTGTGCTGTGTGTTGCACTTTGTCGGCTAAAACTCACTCACCCATTCATATATTTTTTTGTTTACATTGCCGGCTTGTGCGCTTGTGCAGCCCAAACAACAACTGTTGGGAAAGCCTTGTGACGTCACCGACGTCACCGGGAATGTGCGTGCTATGGAACTCGCAATTTGGCTGCTCATTTGAAACTTCCGCAAAATGGCCGAGAAGAGCGAGTTCGCAACGTCATCGGCACGTCATCGGCACAGCATCAACAAGGCTTACTGGCTGCTAAAAATCGTCATGAGATCATTATTCCCATCGGCGAG

Full Affymetrix probeset data:

Annotations for 1633316_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720