Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633320_at:

>probe:Drosophila_2:1633320_at:547:561; Interrogation_Position=1543; Antisense; GGAACTGATTGCACACTATACGAAA
>probe:Drosophila_2:1633320_at:575:329; Interrogation_Position=1593; Antisense; GCGGCGTTAAGGGACTGTTCAAGCA
>probe:Drosophila_2:1633320_at:703:207; Interrogation_Position=1613; Antisense; AAGCAGGGCGACATGACCAAGAATG
>probe:Drosophila_2:1633320_at:316:615; Interrogation_Position=1638; Antisense; TGAATCCAACACAGATGGCCAAGCT
>probe:Drosophila_2:1633320_at:720:311; Interrogation_Position=1655; Antisense; GCCAAGCTCAACCAGCAGATAGCGA
>probe:Drosophila_2:1633320_at:411:673; Interrogation_Position=1674; Antisense; TAGCGAAGATGATCGATCCCCGGAT
>probe:Drosophila_2:1633320_at:557:449; Interrogation_Position=1688; Antisense; GATCCCCGGATGCTGCAACAGATGG
>probe:Drosophila_2:1633320_at:662:573; Interrogation_Position=1712; Antisense; GGCGGCGTTGGTGGTATCCAAAATA
>probe:Drosophila_2:1633320_at:667:129; Interrogation_Position=1788; Antisense; ACCTGATGAGCGGTTTTGGTGGCAA
>probe:Drosophila_2:1633320_at:168:711; Interrogation_Position=1859; Antisense; TTCGCGTAGTTCGTAATTTGTTAGC
>probe:Drosophila_2:1633320_at:716:691; Interrogation_Position=1886; Antisense; TTTGTTTCCATTTGTCCAAGGCCAC
>probe:Drosophila_2:1633320_at:678:5; Interrogation_Position=1990; Antisense; ATTCGGTTTTTGTACGGCTTGGCAG
>probe:Drosophila_2:1633320_at:84:355; Interrogation_Position=2011; Antisense; GCAGCCACAGTGTCAGTTTTTATAG
>probe:Drosophila_2:1633320_at:216:707; Interrogation_Position=2069; Antisense; TTAGCATGCCTATCAGAATACCAGT

Paste this into a BLAST search page for me
GGAACTGATTGCACACTATACGAAAGCGGCGTTAAGGGACTGTTCAAGCAAAGCAGGGCGACATGACCAAGAATGTGAATCCAACACAGATGGCCAAGCTGCCAAGCTCAACCAGCAGATAGCGATAGCGAAGATGATCGATCCCCGGATGATCCCCGGATGCTGCAACAGATGGGGCGGCGTTGGTGGTATCCAAAATAACCTGATGAGCGGTTTTGGTGGCAATTCGCGTAGTTCGTAATTTGTTAGCTTTGTTTCCATTTGTCCAAGGCCACATTCGGTTTTTGTACGGCTTGGCAGGCAGCCACAGTGTCAGTTTTTATAGTTAGCATGCCTATCAGAATACCAGT

Full Affymetrix probeset data:

Annotations for 1633320_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime