FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633321_at:

>probe:Drosophila_2:1633321_at:15:671; Interrogation_Position=161; Antisense; TACTGGGCCACAATGCAGCGGATGC
>probe:Drosophila_2:1633321_at:454:113; Interrogation_Position=192; Antisense; AGCAGCAGTAGCTAGTCGCCTGGCC
>probe:Drosophila_2:1633321_at:536:599; Interrogation_Position=226; Antisense; TGTCAGCATCCCATTAACAACAGCA
>probe:Drosophila_2:1633321_at:268:541; Interrogation_Position=323; Antisense; GGTTCATATCCCTGCTGCACGTGGC
>probe:Drosophila_2:1633321_at:499:521; Interrogation_Position=343; Antisense; GTGGCCAGCTACGTGCTGTGCCTGT
>probe:Drosophila_2:1633321_at:670:319; Interrogation_Position=382; Antisense; GCCCTCTACGGCAATGTGCGGCAGA
>probe:Drosophila_2:1633321_at:96:553; Interrogation_Position=414; Antisense; GGAGCAACGGATGCAGCGCCTCCAA
>probe:Drosophila_2:1633321_at:359:587; Interrogation_Position=443; Antisense; TGGACGCCCGCATCGTAGAGCTGGA
>probe:Drosophila_2:1633321_at:148:497; Interrogation_Position=530; Antisense; GTCATCCCAGCGACAGAGACAGTAG
>probe:Drosophila_2:1633321_at:302:111; Interrogation_Position=575; Antisense; AGCACCTCGAGTTGCACGTTCGACG
>probe:Drosophila_2:1633321_at:113:137; Interrogation_Position=590; Antisense; ACGTTCGACGGGAGTTGCACCGTCT
>probe:Drosophila_2:1633321_at:652:295; Interrogation_Position=616; Antisense; CGACGGGATGTTTCGCATCTGCAGC
>probe:Drosophila_2:1633321_at:192:347; Interrogation_Position=630; Antisense; GCATCTGCAGCTCACGAGACGCCAG
>probe:Drosophila_2:1633321_at:248:425; Interrogation_Position=645; Antisense; GAGACGCCAGCAGCGACGACAGGCA

Paste this into a BLAST search page for me
TACTGGGCCACAATGCAGCGGATGCAGCAGCAGTAGCTAGTCGCCTGGCCTGTCAGCATCCCATTAACAACAGCAGGTTCATATCCCTGCTGCACGTGGCGTGGCCAGCTACGTGCTGTGCCTGTGCCCTCTACGGCAATGTGCGGCAGAGGAGCAACGGATGCAGCGCCTCCAATGGACGCCCGCATCGTAGAGCTGGAGTCATCCCAGCGACAGAGACAGTAGAGCACCTCGAGTTGCACGTTCGACGACGTTCGACGGGAGTTGCACCGTCTCGACGGGATGTTTCGCATCTGCAGCGCATCTGCAGCTCACGAGACGCCAGGAGACGCCAGCAGCGACGACAGGCA

Full Affymetrix probeset data:

Annotations for 1633321_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720