Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633322_at:

>probe:Drosophila_2:1633322_at:385:273; Interrogation_Position=1248; Antisense; CTTCCAGGGCGGCAAGCATTCGAGA
>probe:Drosophila_2:1633322_at:56:345; Interrogation_Position=1263; Antisense; GCATTCGAGAAATCCGATCCTGTTC
>probe:Drosophila_2:1633322_at:560:603; Interrogation_Position=1283; Antisense; TGTTCGAGGATCAGCCGATGCCCAG
>probe:Drosophila_2:1633322_at:216:503; Interrogation_Position=1317; Antisense; GTCGCGCGTTGCCAAGACCAAGACG
>probe:Drosophila_2:1633322_at:177:253; Interrogation_Position=1335; Antisense; CAAGACGAACGCTCTGGATCAGGAC
>probe:Drosophila_2:1633322_at:678:543; Interrogation_Position=1350; Antisense; GGATCAGGACTACACGGCCGGATTC
>probe:Drosophila_2:1633322_at:593:221; Interrogation_Position=1426; Antisense; AAGGGCAACCTCAAGGAGTGGGCCA
>probe:Drosophila_2:1633322_at:593:83; Interrogation_Position=1442; Antisense; AGTGGGCCAGGAATAACAACTTCGA
>probe:Drosophila_2:1633322_at:460:191; Interrogation_Position=1459; Antisense; AACTTCGAGGAGGATCGCCGGCGCA
>probe:Drosophila_2:1633322_at:35:577; Interrogation_Position=1478; Antisense; GGCGCAAGAACTACAATCGCTTGTA
>probe:Drosophila_2:1633322_at:537:489; Interrogation_Position=1500; Antisense; GTACAAGTAGATTACTCTGGGCAGT
>probe:Drosophila_2:1633322_at:151:525; Interrogation_Position=1528; Antisense; GGGCTAGTTGTTCATTAGCTTTCCA
>probe:Drosophila_2:1633322_at:369:705; Interrogation_Position=1542; Antisense; TTAGCTTTCCAATCGTAGACTTTAT
>probe:Drosophila_2:1633322_at:581:539; Interrogation_Position=1699; Antisense; GGTATGGAGTTTTTCTTGGATTCTA

Paste this into a BLAST search page for me
CTTCCAGGGCGGCAAGCATTCGAGAGCATTCGAGAAATCCGATCCTGTTCTGTTCGAGGATCAGCCGATGCCCAGGTCGCGCGTTGCCAAGACCAAGACGCAAGACGAACGCTCTGGATCAGGACGGATCAGGACTACACGGCCGGATTCAAGGGCAACCTCAAGGAGTGGGCCAAGTGGGCCAGGAATAACAACTTCGAAACTTCGAGGAGGATCGCCGGCGCAGGCGCAAGAACTACAATCGCTTGTAGTACAAGTAGATTACTCTGGGCAGTGGGCTAGTTGTTCATTAGCTTTCCATTAGCTTTCCAATCGTAGACTTTATGGTATGGAGTTTTTCTTGGATTCTA

Full Affymetrix probeset data:

Annotations for 1633322_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime