FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633323_at:

>probe:Drosophila_2:1633323_at:166:709; Interrogation_Position=221; Antisense; TTACGGCGGCCCACTGTATGGAGAA
>probe:Drosophila_2:1633323_at:62:143; Interrogation_Position=287; Antisense; ACTGGAAGGCCGGTGGACTACGTCA
>probe:Drosophila_2:1633323_at:161:489; Interrogation_Position=342; Antisense; GTACTCGATGAATCCTCGCATTATC
>probe:Drosophila_2:1633323_at:533:7; Interrogation_Position=373; Antisense; ATTGCCCTGGTCAAGGTTACTCCGC
>probe:Drosophila_2:1633323_at:86:301; Interrogation_Position=403; Antisense; CGCCTGGAGCGATCCGATATCAGTA
>probe:Drosophila_2:1633323_at:240:243; Interrogation_Position=429; Antisense; AATTCTAATCGGTGGCTCGGATCGC
>probe:Drosophila_2:1633323_at:603:295; Interrogation_Position=451; Antisense; CGCATTGGCGAGAAGGTTCCGGTAC
>probe:Drosophila_2:1633323_at:318:349; Interrogation_Position=537; Antisense; GCAGGCTTTGAACTATCGCACCATC
>probe:Drosophila_2:1633323_at:161:563; Interrogation_Position=602; Antisense; GGAACGAGATCTGCGCACTGGCTGT
>probe:Drosophila_2:1633323_at:93:405; Interrogation_Position=652; Antisense; GACTCTGGTGGACCCTTGATTAGGC
>probe:Drosophila_2:1633323_at:145:479; Interrogation_Position=668; Antisense; TGATTAGGCCCGGTAAGCAGCCGCA
>probe:Drosophila_2:1633323_at:712:657; Interrogation_Position=681; Antisense; TAAGCAGCCGCACTTGGTGGGAATT
>probe:Drosophila_2:1633323_at:609:517; Interrogation_Position=697; Antisense; GTGGGAATTGTCTCCTACGGATCAT
>probe:Drosophila_2:1633323_at:403:695; Interrogation_Position=769; Antisense; TTTCTGCCCTACATCAGTCAGGTGA

Paste this into a BLAST search page for me
TTACGGCGGCCCACTGTATGGAGAAACTGGAAGGCCGGTGGACTACGTCAGTACTCGATGAATCCTCGCATTATCATTGCCCTGGTCAAGGTTACTCCGCCGCCTGGAGCGATCCGATATCAGTAAATTCTAATCGGTGGCTCGGATCGCCGCATTGGCGAGAAGGTTCCGGTACGCAGGCTTTGAACTATCGCACCATCGGAACGAGATCTGCGCACTGGCTGTGACTCTGGTGGACCCTTGATTAGGCTGATTAGGCCCGGTAAGCAGCCGCATAAGCAGCCGCACTTGGTGGGAATTGTGGGAATTGTCTCCTACGGATCATTTTCTGCCCTACATCAGTCAGGTGA

Full Affymetrix probeset data:

Annotations for 1633323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720