FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633324_at:

>probe:Drosophila_2:1633324_at:61:63; Interrogation_Position=1036; Antisense; ATGTCGCACGCTTTCCATGAAGTTT
>probe:Drosophila_2:1633324_at:291:691; Interrogation_Position=1058; Antisense; TTTGGCCGCGCCGTAAGTTATATAC
>probe:Drosophila_2:1633324_at:429:91; Interrogation_Position=1073; Antisense; AGTTATATACCCGATCTCAATCTCC
>probe:Drosophila_2:1633324_at:487:443; Interrogation_Position=1124; Antisense; GATGTACTCAGTTCTCTGGATTCTT
>probe:Drosophila_2:1633324_at:34:677; Interrogation_Position=1187; Antisense; TAGCTATTTGGCCATCACTTGATGT
>probe:Drosophila_2:1633324_at:205:669; Interrogation_Position=1218; Antisense; TACGGTGTTCCTTAGTCAACTTTTG
>probe:Drosophila_2:1633324_at:300:531; Interrogation_Position=1262; Antisense; GGGTCTATGTGGTCTTTCTCTAATA
>probe:Drosophila_2:1633324_at:327:117; Interrogation_Position=749; Antisense; AGCTTCCGGCGATGCATAATAGGCA
>probe:Drosophila_2:1633324_at:44:691; Interrogation_Position=779; Antisense; TTTGGTTACATGCATCCGCTTCTGA
>probe:Drosophila_2:1633324_at:56:3; Interrogation_Position=832; Antisense; ATTGTTTGAAACTCCCATGCTACGC
>probe:Drosophila_2:1633324_at:103:227; Interrogation_Position=874; Antisense; AAGGCATCAGCCCATCGAAGGACCA
>probe:Drosophila_2:1633324_at:51:105; Interrogation_Position=926; Antisense; AGACTGCGATCTGAGCTGACGAAGT
>probe:Drosophila_2:1633324_at:166:263; Interrogation_Position=976; Antisense; CAGCCGGTGGCTGCAAGTCAAGGAA
>probe:Drosophila_2:1633324_at:360:373; Interrogation_Position=998; Antisense; GAAGTGGATCCTCACCAGGCGACTA

Paste this into a BLAST search page for me
ATGTCGCACGCTTTCCATGAAGTTTTTTGGCCGCGCCGTAAGTTATATACAGTTATATACCCGATCTCAATCTCCGATGTACTCAGTTCTCTGGATTCTTTAGCTATTTGGCCATCACTTGATGTTACGGTGTTCCTTAGTCAACTTTTGGGGTCTATGTGGTCTTTCTCTAATAAGCTTCCGGCGATGCATAATAGGCATTTGGTTACATGCATCCGCTTCTGAATTGTTTGAAACTCCCATGCTACGCAAGGCATCAGCCCATCGAAGGACCAAGACTGCGATCTGAGCTGACGAAGTCAGCCGGTGGCTGCAAGTCAAGGAAGAAGTGGATCCTCACCAGGCGACTA

Full Affymetrix probeset data:

Annotations for 1633324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720